Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36543  (registered. 2012)
Contig Information
Length 1027 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_yd Spikelet at late flowering 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
WH_XA Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242051543|ref|XP_002454917.1|| hypothetical protein SORBIDRAFT_03g001360 [Sorghum bicolor]
Score 356
Evalue 2.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36543
ACCCGTCGCCTCACTGTCACCGACCCCGGCGATCACCGGCGAACAAGGGATCAGTGTACTTCTCTCTCCAAACGCGAAGATGGATGAAGGGAATGTGGCG
CAGCAGCTCAAGCAGATGACGGACTTCATCCGCTTGGAAGCCGTCGAGAAGGCATTCGAGATCGAGGCCGCCGCCGCCGAGGAATTCCAAATCGAGAAAC
TACAACTGGTGGAAGCTGAAAAGAAGAAGATCAGGCAAGACTATGAAAAGAAAGAGAAACAAGTTGCTATCAAGAAGAAAATCGAATACTCAATGCAGCT
CAATGCTTCCCGAATTGAAGTTCTTCAAGCTCAAGATGATTTAGTAAAGTCCATGATGGATTCAGCACGGAAAGAGCTACTGTACCAAAGCCGAGACCAT
CAATCTTACAAGAAACTTCTCAGGATACTTATTGTTCAGAGCTTGCTGCGTCTGAAAGAGTCGGCGGTCATTCTCCGCTGCAGGAAGGAGGATCTTGAGC
TTGTTGAATCGGTCTTGGAATCTGCGAGGAATGAGTATGCGGAAAAGGAAAATGTATATCCGCCTGAAATCATGGTAGACCACCATGTCTATCTGCCGCC
TGCTCCCAGTCATTACAAGGAACATGACCTGTCCTGCTCTGGTGGAGTTGTAATGGCTTCTCAAGATGGAAAAATCGTCTTTGAGAACACGTTGGATGCT
AGACTAGAAGTGGTTTTCAGAAAGAAGCTGCCAGAGATCCGTCAAAGCCTTATTGGGCAGATAGCTGCATGAACAATTCTTGTAAACAGAATGCTGCACA
GCTGCTGCTCGGCACCTCTTGATGATGATCTTCGAGAAATCTTTTTTGTGGTTCACCAGTAATTTACACAGGCTCGCTCTTTTGGTCAGGGGGAAGAACC
CTTTGTCACTGATGACTCGAGACTTAATTATGCCACGCAAGCATAATAAGATGAACTACAGCATTGGGCGATTTCTCTTAATAAGGCATCGATTTGTGTA
GTGAAGCCATTTATGTGTACACGTAAT
page-top