Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36542  (registered. 2012)
Contig Information
Length 899 bp
Clones alternative view 80 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 9
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 11
Wh_r Root 2
Wh_yd Spikelet at late flowering 11
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_MS Seed DPA5 of DT3DL CS wheat 6
Wh_OKCS Seed DPA5 6
Wh_PCDAM Anther at meiosis 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XF Seedling, infected with leaf rust 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|729738|sp|P40621.1|HMGL_WHEAT|HMGL_WHEAT RecName: Full=HMG1/2-like protein
Score 317
Evalue 1.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36542
GAGCGCCCTCCCTCCCTCCCCACCCAGGGAAACCCACCAGCCATGAAGGGGGCCAAATCCAAGGGCGCCGCCAAGGCCGACACCAAGTTGGCGGTGAAGA
GCAAGGGGGCGGAGAAGCCGGCGGCCAAGGGGAAGAAGGGCAAGGCCGGCAAGGACCCCAACAAGCCCAAGAGGGCGCCCTCCGCCTTCTTCGTCTTCAT
GGGCGAGTTCCGCGAGGAGTTCAAGCAGAAGAACCCCAAGAACAAGTCCGTCGCCGCCGTCGGCAAAGCGGCCGGTGAGAGGTGGAAGAGCTTGAGCGAA
TCGGAGAAGGCCCCCTACGTGGCCAAGGCCAACAAGCTCAAGGGCGAGTACAACAAGGCCATCGCCGCCTACAACAAGGGCGAGAGTGCTGCTGCTGCCG
CCCCAAAGAAGGCGGCCGCCAAGGAGGTGGAGGAGGAAGATGAGGAGGAATCCGACAAGTCCAAGTCGGAGATCAATGACGACGATGACGATGAGGGTAG
CGATGAGGACGAGGACGACGACGAGTGAAGAAGACGCATCTTGTCAAGGCTGCTGGCTCCGGCGGACAAAGGCGGGAGCGGCTGCTGCGCGAGAACCGAC
GTGAGCTGTGTGCGGTGGTGTCATAAGGAGCCTGTCCATCTCCACTAGAGTTATCCCAAGTTTCACTTCACATCGTGATGTTGTTTTACCTTTTTTTTCT
TGTCGTCGTCCCGCTGCCTGCTATAACGGACAGCGCTCCCTGTTGGCGCCGACGCCGGCGGGGGTGGTGCCCTGGCGGCGGAGGGTGTATGTCCTCTGCC
GCCGGGTGCTCCCCTGCTTGTACCTAGATGGTTGGTTACTCTTTCCGTCCATTGTCACCGGCTAACATTGTGATAATATCAGTCTGGGTAATGTTAGAT
page-top