Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36528  (registered. 2012)
Contig Information
Length 1504 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 3
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_PCDAM Anther at meiosis 1
Wh_V4816 Shoot grown under cold condition for 16days 1
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218201187|gb|EEC83614.1|| hypothetical protein OsI_29322 [Oryza sativa Indica Group]
Score 716
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36528
ACATTTAGCATTATAGAATCTTTGCAATTCGAACCGACTCAAGATAGCTGCGTTGACATGCAAAGGAGAAAACAACATTGGTAAGTCGGCACAGAATTTG
TTAATCGGAACATTCAATTGAAGCCTGAAGTGCACAACTTCCTACTTCTTATTCTCCATTACTGTTACCACAATTTCAATTCATACACTCAAGTGATCAT
GCCCTGTTACATATCGGTCCATGTCACGATGGCGAGTGTGTGTCGTCCGCCACAGGCAACGTAGTTCGCTTGCCATAGCCCTTCGGAGCTGGTGCTGGTC
TTTGGTGGCGGCAAGTTTATGGGCACTTCCATTGGGTGACCCGTAGTCACCTTCCTACCGTCGCCTAGACGGCCATGATCGCCCCTCCCATAAGAGAACA
TTCGGCCATCACTGGTTAGCACAACTGAATGGGTCCCTCCACATGATACCTGAACAATATCCTCGCCAGCTAGAAGCTGAACCTTTAGCGGCACCATGTG
ACTGCTCTTATCATCCCCAAAGCCGAGCCTCCCATGTTCTCCTCTTCCCCAAGCATATACCTCTCCTTCTTTAGTTAATGCGGCTGAATGCCAACCTCCA
GCAGCAATGTCAACCAATGAGAGGTTAGATAGCCCTTCAACACGGATAGGTTGTGATCTCGGTTGGGTATCTCCAATCCCCAGCTGGCCATATTCATTAT
TACCCCATGCCCACAAGATTCCGTCTACTGACAGTGCCAAATTATGGAATGCCCCTACAGCAATCATGCTCACTTGTTCAAGCCCTTGCACACGTACTGG
CGTAGATATTTTTTTGATATCACCCGGAGGCCACGGTTGTCCCCATGTCCAGACATGGCCTTCTTGTGTCAAAACCACTGAGTGAGTCCCCCCCGCAGCT
ACTTGCCGAACTTTGAGCTTGAGAGCGCATCGCTGTGGGATGGGGATGTCCCTCCTGAGTGCCCTTGTGCCATCTTCCTTCCTCTCAGGCTCCTCCCCGC
ACTGTCCATATTCGTTGCCCCCCCAAGCGTAAGCCCGCCCCTTGTCGTCCACCGCGAGGCAATGCCACCCGCCGATCGCTGCCTGCACGATCTTGACCCC
GATGAGGGCGTCGACATGCGCCGGGGAGCTCTCTGTCTTGGTCTCCGGCGGGTGCCCGAGCGTTCCCCGCTGATTCCACCCCCAAGTGAAGAGGCTGCCG
TCGTTGCATATGGCGAGGGAGTTGCGGCTGCCGGCTACGACGGCGGAGACGGCGTACGCATCCAGAGCGCCGATGCAGCGGGCCCAGTCCTTCTCGTCGC
ATCGGCCCATGCCCAGCTGCCCGTCTTCCCCCGAACCCCATGCGAGGACGGCTACGGGGCGGGAAGGCGGCGCCATATGGGGTGGGGGGAGGGGGCGGCT
CGGGGTCTGAGGTGGCCGGGAAGCGGTGGGGAGATAGCGAAACCGCAGCGGCAAAACAAGAATGCCAGCGCTGGAGGCTGCTTTTGTTGCGGCCCTGTCC
GGGA
page-top