Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3649  (registered. 2012)
Contig Information
Length 950 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_r Root 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|198385788|gb|ACH86230.1|| truncated hemoglobin Hb2b [Triticum aestivum]
Score 357
Evalue 1.00E-96
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3649
TTCGGCACGAGGGTCGCGGGTATAAACGCTGGTGCGCGTCGCCTGAGCCGCACGCCGCCGCGCACTGTCTCTNNNNNNNCACCCGAGCAGTCAACTGAAC
GGCAGCCAACCAAGCGTCCCAGCCGGTCACCGGGAGGCTTCGCCGCGTGGGTGGGCGTCCCGGGAGCAGCAGGAACGATGCAGTCGCTGCAGGACAAGGC
GTCGGAGTGGAGCGGCGTGGCGGCCGCCGACGCCTTCGCCATCGACGAGGTCAACGTCTTCGAGGCGCTCGGCGGCACCCCGCAGCCCTTCGTCGACCTC
TCCACCAACTTCTACACCAGGGTTTATGAGGACGAGGAGGAGTGGTTCCGGGAGATATTCTCGGGTTCCAAGAAGGAGGACGCGATCCAGAACCAGTACG
AGTTCTTGGTTCAGCGGATGGGCGGCCCGCCGCTATTCTCCCAGAGGAGAGGACATCCTGCCCTGATAGGACGACATCGACCATTCCCAGTTACCCACCG
AGCTGCGGAGCGATGGCTGCATCACATGCAGCAAGCTCTGGAGACGACAGAAAGCATAAACCCAGATACAAAACCCAAAATGATGAATTTTTTCAGGCAC
ACTGCATACTTCCTTGTCGCCGGTAATGAGATGACAAGGCAAACGCAAAGTGTACCTCCCTGCAAGCATGCAACGAGCAAACCAGCCGAGTAACCGCTCA
AACTTAACCGGTTGAATAACGATTTCAGCTCCCGTGTTCCTAATAGGATTCCCATGTTCAATGGGATCAAGCTTATTTATGCATTATGCATTATAGGGAA
CGACACGCCTGATGTTCTATGGGCAGCAACACTTGAGCAGAGAGCATCTCAAAATTGATAAATTGCTTACTTGAAATGGTTGTACTTCCTCTTCTCTCTG
GGTTTGTGTTTGAGGGCACAAGTTCCTATGCTGTATAGGTGCTGAACTGC
page-top