Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36430  (registered. 2012)
Contig Information
Length 843 bp
Clones alternative view 139 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 11
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 4
Wh_h Spike at heading date 6
Wh_oh Pistil at heading date 6
Wh_r Root 7
Wh_yd Spikelet at late flowering 22
Wh_CSEC Callus 10
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 8
Wh_OKCS Seed DPA5 11
Wh_PCDAM Anther at meiosis 8
Wh_SHDr Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_SP 20
WH_XA Root 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|90289596|gb|ABD92930.1|| alpha tubulin-2A [Triticum aestivum]
Score 432
Evalue 2.00E-119
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36430
TTTTTTTTTTAAGTTTTTTTTTTAGATAACCAGATAGCATGCATATTAACCAAGGTGCATAACAGGTTCAAAGATACAAGGGTCTTACAACACAACAGGT
TGTAAAACAAACACCACAAAGCAAAGATTCAAACAGACAGATAACAGATAAAGCCACTCGGGCAGATCATGGGATAGCAGCAGCACGCCTTGCGAAAGCA
CCAGGAGGCAGGCTCTAGTACTCGTCGCCCTCGTCACCGTCCTCACCCTCGTCGAACTCAGCACCAACTTCTTCATAGTCCTTCTCCAGGGCAGCAAGAT
CCTCACGGGCCTCAGAGAACTCTCCCTCCTCCATGCCCTCACCGACGTACCAGTGGACGAAGGCACGCTTGGCGTACATGAGGTCAAACTTGTGGTCAAT
GCGGGAGAAGACCTCGACGACACTGGTGGAGTTGGAGATCATGCACACAGCCCTCTGGACCTTGGCAAGGTCACCACCTGGGACAACACCTGGTGGCTGG
TAGTTGATACCACACTTGAAGCCAGTGGGGCACCAGTCAACAAACTGGATAGTGCGCTTGGTCTTGATGGTGGCCACAGCAGCGTTGACATCCTTGGGAA
CAACATCACCACGGTACATGAGACAGCAGGCCATGTACTTGCCGTGGCGGGGGTCACACTTGGCCATCATAGATGAAGGCTCAAAGGCGCTGTTGGTGAT
CTCAGCAACAGACAGCTGCTCATGGTAGGCCTTCTCAGCTGAGATCACTGGGGCATAGGAGGAAAGCATGAAGTGGATCCTCGGGTAGGGCACCAAGTTG
GTCTGGAATTCATTGACATCAACATTCAGAGCACCATCAAACC
page-top