Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36351  (registered. 2012)
Contig Information
Length 541 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195606592|gb|ACG25126.1|| histone H2A [Zea mays]
Score 261
Evalue 2.00E-68
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36351
ACATAACAAGATTAACCGACACCGCTACAGGAACATAACCGGACCACTACTAAGAACACTACGACATGGAATGGGTGGATCTAAGCCTTGGTGGTCTTCT
TGGGGGACTTGGTCGCCTTCTTGGGAGACTTGGGCTCCTTGCCCTCCTTCTCCGCGGTCCTCTTGGGGAGCAGCACCGGGTTGATCTTGGGGATCACGCC
GCCGTGCGCGATGGTGACGCCGGCCAGCAGCTTTCCGAGCTCCTCGTCGTTCCGGACGGCGAGCAGCAGGTGGCGCGGGATGATGCGGCTCTTCTTGTTG
TCCTTGGCGGCGTTCCCGGCGAGCTCCAGAAGCTCGGCGGCGAGGTACTCGAGGACGGCGGCGAGGTATACGGGGGCGCCGGTGCCGACGCGCTGGGCGT
AGCGGCCCTTCTTGAGGTAGCGCCCGATGCGGCCGACGGGGAACTGGAGCCCGGCCTTGACGGACCGCGTCACCGACTTCTTCCTGGGGCCGCCGGCCTT
GCGCCCGGCCGCGCCCTTCTTCCCCTTCGCTGCAGCGCCTG
page-top