Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36311  (registered. 2012)
Contig Information
Length 728 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_yd Spikelet at late flowering 2
Wh_KMP Shoot grown under continuous light 2
Wh_VSCB Liquid cultured tissue 2
WH_XA Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|78100001|sp|P02275.2|H2A1_WHEAT|H2A1_WHEAT RecName: Full=Histone H2A.1; AltName: Full=wcH2A-9
Score 282
Evalue 2.00E-74
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36311
CGGCACGAGGCGCACCGCCGCCCACGCATCTCGAGTAGTTTNNNNCTCGCCGGAGACGCAGCAAGCAAGAAGATGGCCGGAAGGAAGGGCGGCGACAGGA
AGAAGGCGGTGACCCGCTCCGTGAAGGCCGGGCTCCAGTTCCCCGTCGGCCGCATCGGGCGCTACCTCAAGAAGGGCCGCTACGCCCAGCGCGTCGGCTC
CGGCGCCCCCGTCTACCTCGCCGCCGTCCTCGAGTACCTCGCCGCCGAGGTGCTGGAGCTTGCCGGCAACGCGGCCAAGGACAACAAGAAGACCCGCATC
ATCCCGCGCCACCTGCTGCTCGCTGTCCGCAACGACCAGGAGCTCGGCAGGCTGCTCGCTGGCGTCACCATCGCCCACGGTGGCGTGATCCCCAACATCA
ACTCCGTGCTGCTCCCCAAGAAGTCCCCCGCCGCCGCCGAGAAGGAGGCCAAGTCGCCCAAGAAGAAGACCTCCACCAAGTCCCCCAAGAAGAAGGTCGC
CGCCAAGGAGTAGCCCGCCCATAGACTACTGTCGTGACATTGCTTAGGTCCATATCAGGGAGAGGATGATGAGTTTTGGTTGGTTGGATCCTGTGTGTAA
TTGCCTAAGTCTGTAGTGGCTGTTACATTAGTTCGATGAACAAGCCGGTAGATGGGCGCTGTAATTTATCTCTGATTTATGTCCGGAATGGCTAAAGATG
CAATCCTTTCAATCAAACAAAAAAAAAA
page-top