Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36294  (registered. 2012)
Contig Information
Length 418 bp
Clones alternative view 18 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_h Spike at heading date 4
Wh_yd Spikelet at late flowering 5
Wh_VSCB Liquid cultured tissue 1
WH_SP 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115440899|ref|NP_001044729.1|| Os01g0835900 [Oryza sativa (japonica cultivar-group)]
Score 209
Evalue 1.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36294
TTCCCTCGGTAGGCAGCTTCCATCTCATCTCCGGCGATGTCTGGGCGCGGCAAGGGCGGCAAGGGGCTCGGCAAGGGCGGCGCCAAGCGCCACCGGAAGG
TGCTCCGCGACAACATCCAGGGCATCACCAAGCCGGCGATCCGGAGGCTGGCGAGGAGGGGCGGCGTGAAGCGCATCTCGGGGCTCATCTACGAGGAGAC
CCGCGGCGTCCTCAAGATCTTCCTCGAGAACGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAGACCGTCACCGCCATGGACGTCGTC
TACGCCCTCAAGCGCCAGGGCCGCACCCTCTACGGCTTCGGCGGCTGAGCGCCGTGAGCTCGCCGGCTGACCCTGCTGTTTCCTGCGTGGCTGCGTTGCT
CTGTAGTCGTACCCCCCC
page-top