Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36281  (registered. 2012)
Contig Information
Length 968 bp
Clones alternative view 28 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 2
Wh_yd Spikelet at late flowering 4
Wh_EM Dormant seed with water absorption 3
Wh_PCDAM Anther at meiosis 4
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_SP 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242036017|ref|XP_002465403.1|| hypothetical protein SORBIDRAFT_01g038060 [Sorghum bicolor]
Score 410
Evalue 2.00E-112
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36281
TTTTTTTTTTAAAGTAACAGATACTTTTAACTTCTTAAACAACAAGTAAGTCACTTCCAAGAAATACAGGGTTAGAAAGCCAGCACAAGCACAGCACAGC
AGCTTGAAAGCTTAGGGTTGAAAATCTTACAGTTACAGATTTCTTTTGGCCGGTTCCGAGATCACATGGATTTGTTTCACTTTTTGGCGTATGAGATGGC
CATTGGGTTCTCTGGGCTGATCTTGAAACCCTGGAGGGCTTCCATTGCAACCATGGACTGGTTCTCGTCCTCGTACTCCACAAAAGCAATGCCTGGCTTG
GCTTCGATCATCCGCACCTCCCGGAAACCAGGGTATTGCTGGAACAGGATCTGGAGCATCATGCTTGTGGTCTGATCCGGCATGTTCTGGAGGAAGAGGA
TGTTGTTCGGCGGAGCAGCTGGCTCTTGCGGAGGCTTGGCAAAACGAGAAGGTTGATGACCAGTTCCATTGCTTGGGGCAACAGGAGCATTAGCACCAGG
TTGTTGTCCATCTTCAGTTCGCCGTTTTTTCTCAGCAGCTTTCTCCTCTTGCTTCTTCCTTTTCTCTTTAGGAGCATAAGACCCATCTGCTTTTGCAAAA
CAGTCAGACTTTGTTTTTGCATATTGTACCCGCATTTTTTTGCCGTAAAAATCAAAGTCCTGTAGGCCCCGGAAAGCATTGGTAGCCGCTGTAATTTCAC
TGAATGCCACCCAGGCTTGCCCCCTGAGTTTATGAGTTTTCAAGGCCACAACATCCACTATCCTTCCATACTGAGAGCACAATGCATAAAGTGATCTCTT
CAACTCTTCTTTCTTGACCTTCTCGTTGAGGTTCCTGAAGTAGACGGTCTGGTTCGGGGGAACGTCGCCGGACAGCATCGCCGCCGCCGCCGCAGCAGCC
GAAGACGAGGAGGAGAGAGACCTTACTGTTTCGGGCCGGGCCTCGTGCCGAATTCCTGCAGCCCGGGG
page-top