Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36274  (registered. 2012)
Contig Information
Length 848 bp
Clones alternative view 147 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 3
Wh_oh Pistil at heading date 4
Wh_r Root 4
Wh_yd Spikelet at late flowering 6
Wh_SH - 2
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 8
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 12
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 10
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 17
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 7
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 5
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 7
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 11
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_SP 5
WH_XB Root 3
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XV Leaves, plant was grown at constant 23Ž 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|296083584|emb|CBI23573.3|| unnamed protein product [Vitis vinifera]
Score 266
Evalue 3.00E-69
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36274
CGGCAACCCACTTCGGTCGCCTTCCGATTCGAACCTCCCCCAAATCCGCAGCAGTCGACAGGAGGCCAAGCCACCGCGATGGCCCGTACGAAGCAGACCG
CCCGCAAGTCCACCGGCGGCAAGGCGCCCCGCAAGCAGCTCGCCACCAAGGCGGCGAGGAAGTCGGCGCCGACCACCGGCGGAGTGAAGAAGCCCCACCG
CTACAGGCCCGGGACCGTCGCCCTCCGGGAGATCCGCAAGTACCAGAAGAGCACGGAGCTGCTGATCCGCAAGCTGCCGTTCCAGCGCCTGGTCCGCGAG
ATCGCGCAGGACTTCAAGACCGACCTCCGCTTCCAGTCCCACGCCGTGCTGGCCCTCCAGGAGGCGGCCGAGGCGTACCTCGTCGGGCTGTTCGAGGACA
CCAACCTGTGCGCCATCCACGCCAAGCGCGTCACCATCATGCCCAAGGACATCCAGCTCGCCCGCCGCATCCGTGGCGAGAGGGCCTAAGCCGTCCTCCC
CGTCAACGCCGTTAGTGGATCGGAAGTGGAATGTGTTGCTTCCGGTTGTAGTTTGTTCCTAATTGCCGTGCTAGGTCTATCTTCTTCTGTGTAGAAGAAA
TATGGTTGTTGGAGTAAGACGAACTTGATATGTGATGATGTTCCTTCTGGTTTGCGATGAAGCAAACGTATGTTTATGATGCAGACCTCAGAACCATTGT
TGTAGGCAGCATCACTGCTGTCGTCGTGTGTGATTGTTTGCTGTTTTTCTGAGTTGTTTTCAAAAAAAAAATGCTGTTGTGACAGGGATCAGGTGACATG
CACCTTTGCATGTCACCTTGCGGCCTAAATTCATATTTAAAAAAAAAA
page-top