Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36272  (registered. 2012)
Contig Information
Length 794 bp
Clones alternative view 46 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 6
Wh_CSEC Callus 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125542092|gb|EAY88231.1|| hypothetical protein OsI_09683 [Oryza sativa Indica Group]
Score 325
Evalue 3.00E-87
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36272
TTTGGAATGGTAAACGATAATTGTCGTAAAACTCAGTTCCGCCGTCGGTTCGGACAGAACCCACGGCCGAGACAAAACCAACCGGAGGAGCGCTAGAAAT
GAAAGATGGGCCAGAGTTCTCACAGGACCATGTCTCTGGCATATACAGTAATAAGATGCCAATCAACCCTGAACCAACAAGGAACCCTTCACAACAATGA
ATGGCGTGACAAGATTACGACGACTCTTTCTTCTCCTCCGGCTCAGGTTCCTTCTTCGCCTCGGGTTCCTTCTTCTCCTCCGCGGCCTCTTCGAAGGTCT
CTCCTGGGACGAGCTCTGGGACATCGTCGTCATCGTCCTGGGCAGCACCGATGCTGGCGCCGCCAGCCTCACCACCAGGCATCTGCTTCTGGAACTGCTC
AGCAAGCCTCCGCAGGTTGTCCAAGTTATCCGGGCCCAGTTGGTTGATAATTGTCGGCAGTAAATCTTGCAGCTTTTTCGTCTGTGGTGTTCCACTGACT
ACCCATGTGTTTGCGGCAATTGATGCTTGCACTTTCGGGTTCTGAAATTGGATGACAACGTCATCCTTGAAAATATTGACCTCTTCAATACCAGGAATGG
TGTTCACTCCTACTCTTTTCAAGGTGCTCTGGAGCCTCTTGTCATCGGTTGTCGTGGTCTTGTGCACTGCCTTCTTCTTCCTGCGCACGCTGCCCTTGCC
GCCGGTGCGCACGGCACCGGCCATCTTCTTCAGCTTGTCGACATTCATCTTTGGCAGGCGACGGCGGCGGCGGCGGCGAGGGGAATGGGGGGAT
page-top