Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36250  (registered. 2012)
Contig Information
Length 899 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115488866|ref|NP_001066920.1|| Os12g0530000 [Oryza sativa (japonica cultivar-group)]
Score 217
Evalue 1.00E-54
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36250
ACAGAGTAGCACAGTACAGGTCCCAGTACCAAGAGAAACACAGACGAGTTACTNNNNCAAAGTTCAGACTTCAGAATCATGGTCCCTCTCCTCACTCTCT
CCAACACTCTCTTCTTCCTCGCAGAAACGCCGGCTCAATCATTCAATCACAAGGCGACACACGACCCCCCTCGCTCCCTCCATCTCTCCGGCGACCACCG
TAGTACCACCCTACCCCGTCCTCCCCACTCCAGCGATGGCGACAGCGGCAGCCGGCGGCGGGAGGGGCAAGCCGAAGGGGAGCAAGTCGGTGTCGCGGTC
GGTGAAGGCGGGCCTGCAGTTCCCGGTGGGCCGTGTCGCCCGGCACCTCAAGGTCGGGCGCTACGCGAAGCGCGTGGGCGCGGGCGCGCCCGTCTACCTC
TGCGCCGTCCTCGAGTACCTCGCCGCCGAGGCCCTAGAGCTGGCCGGCAACGCGGCGCGCGACAACAAGAAGACCCGGATCTCGCCGCGCCACATCCAGC
TCGCCGTCCGCAACGACGAGGAGCTCAGCCGGCTGCTCGGCGGCGTCACCATCGCCGCCGGCGGCGTCCTGCCCAACATCCACTCCGTGCTCCTCCCCAA
GAAGGCAGGCAAGGGCGCCGGCACCGGCGGGTCCGCCTCCCAGTCCCAGGAGTTCTAGAGCGCCAGAGATCCGATGAGTGGCGTGGCGTGGCGTGGTGGT
GTGATGCTTTTAGGTTGGTAGATTAGTTCTTCTTGGCCAGCGTTCTTGTTGGCGCGTGTATCGAGGGTGGATTTGGTTGGAATGGAATGCTTGCAATCTG
TTTCATGTCTGTTTGGATGGAATGCGGTCTATTTCTTTTTGCTACTTGTCGCTGCCTATGATTTGCGAATGTTAATCTGAATGAAACTGAAAAAAAAAA
page-top