Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36244  (registered. 2012)
Contig Information
Length 686 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 3
Wh_SHC Shoot grown with cold treatment 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XF Seedling, infected with leaf rust 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|68036648|gb|AAY84878.1|| U1 snRNP-interacting 70 kDa protein [Triticum aestivum]
Score 336
Evalue 1.00E-90
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36244
AATTACATAGAACATCACTAACAAGTGAACACAAACCACAAGCATTATCCAGCAAATTATTACAAATAGCATACAACAAACAAACACACACAAAATAAGT
GGGATAAGACTGGAAGTGCCGACAAGAAAAAGGCGAGAGAACCACTGGGAACAGCTGAAATGATGCGAATATTACTGTGTTAACAAAGCCTTACCACAGC
TATCAAGTTTTAGTTCCTGTATTCACTCGCTTGGATATGCTGGTAGTCCCCTTCTTCATATGCCTCCCCTTCCTCGGGGACTGCAGGTTCTGCATTTTCA
GGTTGCCCCTGATGGTTGGTTGCCATTTTACTGTGTGGATCATCCCGGTAATGCTCATGTCGCTTTGAGCGCTCATGTCCATCTAGGCCATAACCATACT
GTTCGTGACTTCTGTGGTGCTCATGCTGGTTATAGCCAAGCTCACCATTGCCATAATCAGCATCACTCTCCTGCAAGTGACCACGATCATGTTCATGGCG
CGCACGCTTGTAATCTCGGTCCCTGCCAGGGTCCTGTTCATGACTTGCACGCTCGTAATCTCTGTCACGGTCTCTGCCCCTGCCATGAGAGCGCTCACGT
TTCCTGTCTCTATCCTGGTCTCTATCCCGGCCATGATCCTTGTGCCTATCCCTATCACGCCGGTCACGCCCACGGTCTCTCTCCTG
page-top