Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36208  (registered. 2012)
Contig Information
Length 698 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 5
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 8
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115484693|ref|NP_001067490.1|| Os11g0211800 [Oryza sativa (japonica cultivar-group)]
Score 171
Evalue 6.00E-41
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36208
TGACATTTTATTTATTGGTGATTACATGACTCAAAGGAACGGCCCTGGGAGCTCGATCCTTCTCACATCCCGCCACGCCATTGTCGCGTCCATCCCCACG
ACGCAGGACGTGAAGAGCGAGTCCAAGACCGGAAGCTAGACTCGGTACTGCGAGCTACCTATTCTCGCCACCACTACTTGCACGGCGTCACACAACTCGT
GAGCTCATGCACAACACGTACCTGACAGTACACGCTAACAAACTAACAGACTCGATACTTGAACAGAGCTTGTTGATCATGAGCAACAAGCTAGGGACCG
AACGCAGAACGCGATTTATTGTGACACAGATGCGTGATAAGCTAATAATAAAATGGACACGTACGTGCAGTTCATTCCTCACACCGCGTGCCGTAGCAAA
CCCCGGCAGGATATAAACAACCGCAGTTACCGCAGCAATCCATAGGACGAAACATGCAAAAACCGCCTGCTGGGAGGCAAGCCAGCTTTGACTCTGCCAA
GACGACATCCATGAGGCGAGGCATCTGCAACTTTCTTGCCGCCAGCATGCTGGGCGGCGTGGCCGAAGCCGGCTCCACAGCTGCCATCAGCAGCAGCGCC
GCCAGGATCGCCACCACCGCCATCTTAGTGGTCGCCATTGCCTCTCCTCTCTGCCTGTGCCTGTGCCTGTGTGTGTTCTTTCCTGGGCGCCCTCGTGC
page-top