Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36202  (registered. 2012)
Contig Information
Length 715 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_r Root 4
Wh_yd Spikelet at late flowering 11
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHC Shoot grown with cold treatment 1
Wh_VSCB Liquid cultured tissue 6
WH_SP 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|122044864|sp|P05621.2|H2B2_WHEAT|H2B2_WHEAT RecName: Full=Histone H2B.2
Score 285
Evalue 3.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36202
CAAACTCACGCCCCCCACCACCGAAGCTCCCAACCCCACCCGAAGCGGCAGCCATGGCCCCCAAGGCAGACAAGAAGCCGGCGGCCGAGAGCAAGGTGGA
GAAGGCGGCCGAGAAGACCCCCGCGGGCAAGAAGCCCAAGGCCGAGAAGCGGCTGCCGGCGGGCAAGACGGCGTCCAAGGAGGCCGGCGGCGAGGGCAAG
ACCCGGGGCCGCAAGAAGGGCAGCAAGGCGAAGAAGGGCGTGGAGACGTACAAGATCTACATCTTCAAGGTGCTGAAGCAGGTGCACCCCGACATCGGCA
TCTCCTCCAAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGCTCGCCGGGGAGTCGGCCAAGCTCGCCCGCTACAACAAGAAGCC
CACCATCACGTCCCGGGAGATCCAGACCTCCGTCCGCCTCGTCCTCCCCGGGGAGCTCGCCAAGCACGCCGTCTCCGAGGGCACCAAGGCCGTCACCAAG
TTCACCTCCTCCTAGACTGACGACGCGCCGCTTGTTGTGACAGATGTGGCCGTCTGCTGTATCTGTAGTCGCTGTTGACTCTGCTTATCTCCATCTGCAA
GTAGTGGTAGCTGTAGTGCGCGTGCTGGGTGATGATTGCCAACGCTTTGTTGGCTGGTTGGATGTAAGAACTGAACGTGTTGCTTTTGCAAACTGATGAA
ATCTATCTAAAAAAT
page-top