Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3620  (registered. 2012)
Contig Information
Length 821 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 6
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 5
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242033941|ref|XP_002464365.1|| hypothetical protein SORBIDRAFT_01g017020 [Sorghum bicolor]
Score 237
Evalue 1.00E-60
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3620
CAGACTCCGGCGCCACCGCGCACGCACGCACGCACGCGGAGCGGGGGGCTGTCCAAAGCGCGTGATCCATTTCCTCCTCCTCTCTCGGTGCGTGCGCCAC
TCCGTCGGCCCGCCCGTCCCCCTCACCGGCGACTTCTCGCCTCGCGGCCGCTCCCAGGGCAGCGTGGGCGCGTGTGTTGCGAGCCATGGCCGGCGAGAAG
AAGATGTTCGGCTTCGAGGAGGTCGCCAAGCACAACGTCGCCAAGGACTGCTGGCTCGTCATCGCCGGCAAGGTGTATGATGTTACCCCTTTCATGGATG
AGCATCCTGGTGGAGATGAGGTACTGCTGGCAGTAACCGGGAAAGATGCAACCAGCGATTTCGAAGATATCGGACACAGTGATTCCGCAAGGGAGATGAT
GGAGAAGTACCACATCGGGGAAATTGATGCTTCAACCATCCCAGCAAAGCGTACATTTGTACCTCCTCAGCAAGGGTCCCATGTCCAGGCCAAGGATAGC
GACCTCCTCATCAAGATCCTGCAGTTTCTTGTTCCCATTTTAATCTTGGGGCTTGCATTTGGTATCCGGCACTACAGCAAATCTGAGTAGGCTGTTGTTG
GCGAGTTGCTTCGGAGAAATAGCTTTCAAGTAATATGGTTTGAGTTAGAACAACATAATAATGGTATTGGTTGGCTGGTTTGAGTTAGAACAACATAATG
ATGGTACTCGTTGGGTGGCAGTGTGTTGTCTCATTGATCATACAAGGCACTCTCAATTTGAAACATCCATATGTATGCCCAGATTACTCGAATTATGTTT
ACATTCTCAACAAAAAAAAAA
page-top