Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36195  (registered. 2012)
Contig Information
Length 970 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
WH_SP 1
WH_XA Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115486733|ref|NP_001068510.1|| Os11g0696200 [Oryza sativa (japonica cultivar-group)]
Score 565
Evalue 4.00E-159
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36195
AATTCGGCACGAGGCATCGCTCTACTCCGCTTCNNNNNNNNNCACCTCGCGCGCGCTCTACCCACCATAAGCCTTCGGGCCTTCCGGGAGCCCAAGCCAT
GGCGCGGAAGAAGATCCGGGAGTACGATTCCAAGCGCCTCCTCAAGGAGCACCTCAAGCGCCTGGCCGGCATCGACCTGCACATCCTCTCCGCCCAGGTC
ACACAATCGACGGACTTTGCGGAGCTTGTGAACCAGCATCCATGGCTGTCGACCACCAAACTGGTTGTGAAGCCTGACATGCTGTTCGGGAAGCGTGGGA
AGAGTGGCCTTGTGGCACTCAACCTGGATGTAGCCCAAGTCAAGGAGTTTGTGAAGGAGCGGTTGGGAGTCGAGGTCGAGATGGGTGGCTGCAAAGCTCC
AATTACCACCTTCATAGTTGAGCCGTTTGTCCCCCACGATCAAGAGTACTACCTTTCAGTTGTGTCCGAAAGGTTGGGTAGCACCATTAGCTTCTCGGAA
TGTGGAGGCATTGAAATCGAGGAGAACTGGGACAAGGTTAAGACAGTCTTTCTTCCGACTGAGAAGCCAATGACACCTGATGCTTGTGCTCCCTTGATTG
CAACCCTTCCACTGGAGGCACGCGGAAAGATTGGTGATTTCATCAAAGGAGTGTTTGCTGTCTTCCAAGACTTAGATTTCTCATTTATTGAGATGAACCC
ATTCACCATGGTGAATGGGGAGCCATATCCGCTGGACATGAGAGGAGAATTGGATGACACTGCATCTTTCAAGAACTTCAAGAAGTGGGGAAATTTAGAA
TTCCCTCTACCATTCGGCAGAGTTCTCAGTTCTACAGAAAGTTTTATCCATGAGCTGGACGATAAGACCAGCGCGTCTTTGAAGTTCACAGTTTTGAACC
CAAAGGGACGCATCTGGACAATGGTTGCTGGAGGTGGTGCCAGTGTCATATACGCTGACACGGTTGGAGA
page-top