Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36150  (registered. 2012)
Contig Information
Length 1447 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XV Leaves, plant was grown at constant 23℃ 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218193680|gb|EEC76107.1|| hypothetical protein OsI_13368 [Oryza sativa Indica Group]
Score 518
Evalue 9.00E-145
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36150
TGCCTCGATAGACTGATAATGCTGAGGCAGAGCTCTAGTAGGANNNNNAGATCGAAAGGTCTGAAGCTAAAGAAAGTTCTTCAGATAAGTCTTTTGGTTC
TTGTGTCTGTTTGGTTGCTCTACCAAGTAAAGCATTCGTACGAGAAGAAGACGGCATATAATGAAAATGATGCCACCAGTCACGAAGCCGGTGATGAGCA
TAAAGATGGTCAGAGCCAGGTGGGCGTCATAAAATTGGGCAGGAAAGACCTGCCAGCAAAGGAGGCCGACTCGTCAACACTGGATGAACGGGTCGAGGAC
GAAGAGAATGAGGAGATGGAGCAAGTAATGAAGCGTGATGAGCATGATGATGACCCCATTGATGAGCCAGACCTGGACAAGGATGAGGATCTTCCTGAGC
CTGGGGAGCACTCGGCTAACAAGGATGAAGGGTCAGATGGCAGGGCTGTGTTTGAGGACGAAGAGCGGAAGGAGCGCTCTCAGGAGGACCAANAGAAGAG
TTTCCATGATGATGATGTATCCAGTGCTGTAACACACGACCCTCCGTCATCGCAGCAAGATGTGCTGACCCATCATGCCCAAGAGAAGATCTTATTCGTG
GATGATGCTTCAACTTCGGTTCCTCATGAAAACCAGGAACCTGAGCACAAGGAGGAGGAAGATCGCAAGGCCAGGGAGAAGAGTTCTGGAGGTAACAATG
TGTCAAGTTCATTGGACCACGATGCCCAAGTCACGAATCCTCTCCCCGACGAACAACTGAAGAACATGGATAGGATCTTTGAAGGCACCACCAATTTGTC
AAATGGAATTACATTCCGGGGTCCTGGAGTGAATGGAACCAATGAGGCTTCTTCAACTAATGCATCGTCCAACCCAAATATGAGCACTCCCAGCATGGTC
TCGGAAAGCAAGACTGATCCAACTCCAGTGAATATGACAAGCAACCATGCTGGATCAGGGACAGGCAATTCAACCTCTTTGAAAGGTCAGCATGAGCAGC
CAGTAAATTCAACAGCAGCGTCGAACAGCCAAACACAACTCTTAGCTGACCTGACATCAGCCGAGCTGAATTCTCCACCGAATGGGACTACGGTGGCTTT
GGATTCAACCGATGCCCAAAAGGCCGCATCCAGAGACGGAGACAGCGTCAGTAACAACACCGACACATCCTCCACCCTGGTGAACAACAAAGAAGACGGC
GGCGGCGACACTCAGAAAGAAGACCAAGACGTGTCGACGAAAATCATGAACAAGGCGATCGGCGAAGGCGAAGTTCTCCTGGAATGATCTCTCTTCTCGC
ATGACCTGTAAGTTTGTAGGACTTCCATCCAAGATGAGCGCCGCGAGTGCCCCGCTTTTTGTGTAAGTTTGGTACCTAGGGACCTGCTTTGTGTTTGCCT
AGAGCACATCACGGTATGTATGGGGCATGCGATGAGCGAGAAGCTTG
page-top