Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36132  (registered. 2012)
Contig Information
Length 858 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
WH_XI Two-week old seedlings(22℃ 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_CA 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|51469000|emb|CAH18000.1|| Ankyrin protein kinase-like [Poa pratensis]
Score 379
Evalue 3.00E-103
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36132
GTTGCAGCATGAGCAAAATTACAGAAACTAAAGCAATAATATTTCTTGACAATACATCCTTCAATTAACCAGAGTAACTTCATGCCGAGTGACGAATGAA
ATTAAATTACAAAACTGTTACAACAATATACTGCTACCGATGAACCTTGGTTGCTTCATTGCTACCCCGGAGAAGAGTAGGCCATTTTTGTTTGCACCTG
ATGACTCCATATCTCAATTCCTGGACGCCAGCTTCAAAGGTGGATCCCAGAATTCCCCGTGTTAGAATATGTTCTTCACGATGCGGCCGTCTGGTTTCCG
CCAACCCAATACTGCTTCACAGCATACAAGATCTTCTCGCGCACTAGAGGGCCGTCCTCGTGGTCAACTAGCTTCGTGTTCCATCTCATGCCCCGAGCGA
GTTTGTTCACCTTTGTCAAGACATCGACATCGTCACGCATTATAACAGCGCCTTCAGGCCTCAAGATGCGGTCCATCTCAAGGAGGATGTCTTCCATGCT
GCACTTATTGCTATACAAGGTGAAAAGGCCACTAGCGTGGATAAGATCATAGGTTCTTGGATAAGTAGAGAAAGCTTCACACCAGTCATGGTAAATGCCA
ATCAATCCTCGCTCATAAACAGCCCCCAGGGTTGCAATCTTTGCAATGGTTGGCACCACATTCATCACCCAAGATTTTGGGGACTCAATCGCCGCAGCAA
AACCCCCAAAACCTGCATTCATGTCCATGATGTTTCTGTACCTACCAGTAAGTAGATACTTGTTCACATTGCTATAAGCCTTCACATGCTTCTTCCACAT
TTTGTTGTCTTTCTGATATGCCTGAGATGAAACCCCTGGAATTAACCCATTAGAAATT
page-top