Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36113  (registered. 2012)
Contig Information
Length 546 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 10
Wh_DPA20 Seed DPA20 2
Wh_SHDr Shoot grown with dessication 2
Wh_VSCB Liquid cultured tissue 3
WH_SP 4
WH_XA Root 4
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195617694|gb|ACG30677.1|| histone H4 [Zea mays]
Score 210
Evalue 7.00E-53
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36113
GCACGAGGACCGTCCCTCCGATTCCACATCCGCTCGCAGCTCGAGATCGTCAGCCATGTCCGGGCGCGGCAAGGGAGGCAAGGGGCTCGGCAAGGGCGGC
GCCAAGCGCCACCGGAAGGTACTGCGCGACAACATCCAGGGCATCACCAAGCCGGCGATCCGGCGGCTGGCGCGGAGGGGCGGCGTGAAGCGCATCTCGG
GGCTCATCTACGAGGAGACCCGCGGCGTGCTCAAGATCTTCCTCGAGAACGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAGACCGT
CACCGCCATGGACGTCGTCTACGCGCTCAAGCGCCAGGGCCGCACCCTCTACGGATTCGGCGGCTAGGCCGCCACCAGATCAGTAGCTAGACTGTCGTTG
TTTGGTAGTACCAGCAGTGCTCGTGGTCCTCTTGTGTAATGGCAGCATCTCGCTGCTGTTAACCCTTGTTGTCTGGATGTACTACTAGGATGGAATGGAA
ATTGTAGCAGTTTGCCCTTGAAAAAAAAAACTATTCAAAAAAAAAA
page-top