Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig36034  (registered. 2012)
Contig Information
Length 557 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_yd Spikelet at late flowering 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226508590|ref|NP_001150048.1|| rae1-like protein [Zea mays]
Score 246
Evalue 1.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig36034
GCGGCAGCGACCGTCTCCGCCTCCTCCTCCCCCCAGACGCCACTTCGAGAATCCTCCACCCTCCCCTCCCTCGGCGCCACTTCGCAGTCCCCACTCGCAG
CCGCGCCGTCCCCAGCAGCCGCCGCCGACCGCTCCCCGTCCGGCAGATTTTGAAGGTTCAAAGAAGGAGAGATGGCAACTCTAACCAGCCTTGCCTCAAA
CCCGAATCCAAACAAGTCATTCGAGGTCCTGCCTAATCCTGGTGACTCGCTCTCAAGCCTCAGTTTTAGCCCGAAAAGTAATCTTCTGGTGGCAACTTCC
TGGGATAACCAGGTGAGGTGTTGGGAGATAGGTAATGGTAACAGTCAGCCAAAGGCATCCATATCACATGATCAGCCAGTGCTCTGCTCAGCCTGGAAAG
ATGATGGGACTACTGTCTTCTCTGGAGGGTGTGATAAACAGGTCAAAATGTGGCCTCTGCTATCTGGTGGGCAGGCTCAGACGGTTGCAATGCATGATGC
ACCTGTCAAGGAGGNNNCATGGATTTCTCAGATGAATCTTCTTGTCTCAGGAAGCTG
page-top