Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35927  (registered. 2012)
Contig Information
Length 971 bp
Clones alternative view 141 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 7
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 5
Wh_r Root 4
Wh_yd Spikelet at late flowering 10
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 6
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_CA 1
WH_SP 3
WH_XA Root 10
WH_XB Root 9
WH_XC Root, treated at 50 microM Al for 6h 25
WH_XD Root, treated at 50 microM Al for 6h 8
WH_XE Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115452901|ref|NP_001050051.1|| Os03g0337800 [Oryza sativa (japonica cultivar-group)]
Score 388
Evalue 6.00E-106
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35927
GCACGAGCGGCAGGTAAGGGAGGAGGAGAGCGGCGGCGAAGATGGTGTCGCTGAAGCTGCAGAAGCGCCTGGCCTCGAGCGTCCTCAAGTGCGGCAAGGG
CAAGGTCTGGCTCGACCCCAATGAGGTCAACGAGATCTCCATGGCCAACTCCCGGCAGAACATCCGAAAGCTGGTAAAGGATGGTTTCATCATCAGGAAG
CCTCAGAAGATCCACTCCAGGTCTCGTGCAAGGAGGGCACATGAGGCCAAGCAGAAGGGCCGTCACTCTGGATATGGTAAGCGTAGGGGTACCAGGGAGG
CTAGGCTCCCCACCAAGATCCTGTGGATGCGGAGGATGCGCGTCCTGAGGCGCCTTCTGCGCAAGTACCGTGAGGCCAAGAAGATCGACAAGCACATGTA
CCATGACATGTACCTGAAGGTCAAGGGTAACATGTTCAAGAACAAGAGGGTCCTCATGGAGAGTATCCACAAGTCCAAGGCTGAGAAGGCAAGAGAGAAG
ACCCTCTCTGATCAGTTTGAGGCGAAGCGCGCCAAGAGCAAGGCTAGCAGGGAGAGGAAGCATGCCAGGAGGGAGGAGAGATTGGCTCAGGGCCCCAGAG
ATCATGCACCAGCACCAGCGGCTGCAGCTCCAGCTCCGGCAGCAGCGGCACCAAAGAAGGCCAAGGCCAAGAAGTGAAGGTCTGACATGAAGCTTTAGCT
TTCTGGTATTATGAAGGGTTAGCCTGATTTTGGAGCATCTGAAGTTCATAACTGTTTTCTGTGCAATATCTGTGTGCCGCGTCTGAGATACCTTAAATAT
CATATCGTGTTTGTTCTGTTGGATGTTTCAGAGATGCTTATGCAGAGTTTCTTTAAACATTTTGGTTCACGGAACCTAGTTTTACATATTCTGTGCGTGC
AAATTTATGTACCTACTGTGTTTGTGNNNNTAATTGGGCGCACAAAAAGTAGATTTACATCACAAGAAAGA
page-top