Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3589  (registered. 2012)
Contig Information
Length 585 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 3
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 3
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig3589
TTTTTTTTTTGCAGGTAATAACTATGTAATCAGTATTCCAGACTGCATATCATTTCATCACCGAAAACCCAGGAACATGGCGATTATTAGGGGCGCCACA
CAAGAGCCTGCAACATATGGACAGCTGCAGCTGCAGGGCTAATCAGTACTATTACAGGACTAAGATCAAGCTTAAGCCTAAGCGGCATTGCTGTGCGGGC
ACGGCGTGGGCTGGCGCGCCTCCGGCGACTGGTTGGAGATGGACATGAGCATCGACCTGGACTTGTCGGCCGCCCCGCTGTCGTCCTGCCCGTGTTCCGT
GCGGCCGTTCGGCGACTTGACGCTCAGGGCCTCTCCCGCCGCCGGGATGGACTGGGAGATCCCGATGAGCGACTGGCGGGCCGCGGCTTCCTCCTGGGCG
CCGGTGGACTTCGTCGGCGTCGTAGGCGAGGCCATCCAATTACCGAGAGCGGAGCGGAGGCCGGGGACGAGGAGGGGCGGAGCAGGGGCAGGGAACAGGG
GAGCTTTTCGGCCGAAGGAAACAGACGATAGGGAGGGAGGGAGGGAAGGAGCCTCGTGCCGAATTCGGCAAGGAGAGAGAACTAG
page-top