Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35795  (registered. 2012)
Contig Information
Length 826 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218191863|gb|EEC74290.1|| hypothetical protein OsI_09541 [Oryza sativa Indica Group]
Score 306
Evalue 2.00E-81
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35795
ACATAGGTCACATACACTCAGATACCACAACATCACGCTAATGACCACCACACAATGACAGAAATATATATAGGTCACATACTCAGGTACCACACCATCA
CACAGCTAATTAATGAAGACAAACTCGCGCTAAGTAAGCACCACAACTGATCGAGTGATCGAGCGAGTTATAAATGACGGCAGCTAGTTGTGGTCGTTGA
TCTGCTCGACGAGTCCGAGGTTGATGATGCCCCAGGCAGAGCGCGGCCATTGTTTCTCCTTGGCCTTGTCCCTCATCACCCTCCCCCACGACACCCACCC
CTCCCACGACATCCTCTTGTCCCAGCTGCTGCCCCACTCCAGCACCAGCCTCAGCCCCTCCGCCGCCGCCGCCTCCGCCTCCTCCCACCTCCCTCCTTCG
TTCAGCAGCACCTGAGCCAGCACCAGCCACGGCTCCCCCACGTACGGGTTCTTCACGATGCAGCGCCGCAGCAGCGACTCCACGCCCTCCTTGCCGTCGC
TGCAGATCGCCTCCCAGTACAGGTCCCTCGCCGCGATCTGCTCGCCGGGGTCCAGCACCTTGCTGCACCGGTCGAACACGGGCGGGATGCAGAGCTCCAG
CCCCTCGTCCTGTTCGTCCCCTGCCGCCGTCTTCGTCGACCCCTCTTGTTCCATGTGGCGGAGCTGCTCGTCGGTGGCGATGAGGCGGTACAGCGCGGCG
AGCCTGGACATGGCGCTCATCCACAGCCCGGGCTTTCCGGTCCCCGGCCAGAGCGCGGCCCAGTTGTCGCCGGCGAACTCGAGGCGGCCGTCGTCGTTGC
GGAACAGCTTGTCCTGGTAGTCCGTG
page-top