Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35794  (registered. 2012)
Contig Information
Length 1336 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XF Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218190234|gb|EEC72661.1|| hypothetical protein OsI_06196 [Oryza sativa Indica Group]
Score 523
Evalue 2.00E-146
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35794
GACCGGCCTCCTCTCGACTCGGCTCCGCCGCTCCGCCCCCGCCGACCACCACGAGGGTTTACTGTCGTTGGCTGAATCGAGAGCTCGTGCGTTCGTGCTA
GTCGCTAATCCGCGGACCGGCGGTCGTTGTGTCGTTGATTCGCCATGGGGAGCAAGGGGCGTATGCCTCCTCCTTACCACCACCGGCCGCTCCCTGGTCC
CGGCTCTGGCCCGCCGCATGGCATGATGCACCGTGATCCGTACGGCCCGGGCATGCACCCACCGCCAGGGCCGGGGCCATACCCCTACGATATGTTGCCG
CCGCCTGAGATCCTGGAGCAGAAGCTCGCGGCGCAGTGTGGAGAGATACAGAAGCTGGCGCTGGAGAATGAACGGCTCGCCGCGAGCCATGCGTCTCTGA
GGAAAGAGCTCGCTGCCGCGCAGCAGGAGCTGCAGAGGATACAGGCGCAGGGGGAGGCGGCGAAGGCCGCCCAGGAGCAGGAGATGAGGGGGCTCCTTGA
TAAGGCTGCCAAGATGGAGGCCGATTTGAAGTCCTACGAGTCTGTCAAGGCGGACCTGCAGCAGGTGCACGCCGAGGCGCAGAACCTGGCGGCGGCAAGG
CAGCATTTGTTGGCGGATGCGCAGAAGCTGAACAAAGACCTGCAGAGGAACTTTGGGGAGGCGCAGCAGCTGCCAGCACTCACGGCTGATCTTGATGCTG
CTAGACAGGAATATCAGCACCTCAGGGCCGCATATGAGTATGAAAGGAAACTGAAGGTGGACCACTCCGAGTCGCTGCAGGGAATGAAGAAAAATTATGA
CTCCATGGTTACAGAGTTAGAGAAGCTTCGTGCTGAGTTGACAAACACAACTAATATTGACAGAAGTGGTACTTTGTACAATCCTAATTTTGCTCAGAAG
GATGGCGGTACATCTAGCCACCATTCTGCTTATGATGGTGGCTATGGGGTTGCACAGGCTAGGACGCCCCCTGGTATGCCAGACCCTTTAAGCGGAAGCC
CAGCTGGAACTGCTCCTCGTTCTGGATATGATCCATCAAGAGGGAATTCATATGAGACTTCTCGTCTTGCTAGAGTCCATGATGCATCAAGGGGTGCTAC
TGGTTACGACTCTCTGAAAGTTGCTGGATATGATACTTCTAGAATGCCTGCACTTGGAGCTCAGGCAGCGGCTCCAACTGCTCATGGGAGTAGTGCTGGT
TACTATGGATCAAGTCAGGTCACACCACCTTCGCATGCACGGGCACCAGGTGCACCCACCTATGGATCTGCACAGGTGCCACCATCATATGCTTCTGGGC
TAGTCCCATCTTCATCATACGGCGCAACAACAGCTC
page-top