Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35792  (registered. 2012)
Contig Information
Length 546 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
Wh_EM Dormant seed with water absorption 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115444405|ref|NP_001045982.1|| Os02g0162500 [Oryza sativa (japonica cultivar-group)]
Score 284
Evalue 3.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35792
ATTCGAACACCGAATTCTCGATCACGGCCATGAGAGACGATGAAAAAGAAGGCGTCTACAGCCTCCTTCCTCTCCTACCACCCTTTCTGCGGGTGCTGTC
AGTGGGAACGGGGGTCACGTCCTCAATGCGTCCAATTTTCATGCCAGAACGAGCGAGTGCCCTGAGAGCGGATTGAGCACCAGGTCCAGGAGTCTTGGTC
TTGTTGCCTCCAGTGGCACGGAGCTTAATGTGCAAAGCAGTGATGCCGAGCTCCTTGCAACGTGTCGCCACATCTTGAGAAGCAAGCATAGCTGCATATG
GTGATGACTCGTCACGATCAGCCTTGACCTTCATTCCACCAGTGATACGAACAAGGGTCTCTCTCCCGGACAAGTCAGTGACGTGGATGAATGTGTCATT
GAATGATGCAAAGACATGAGCAACTCCGAAGACATGCTCCCCTTCACGGACAGCAGGTCCAAGAGTAACATTCTCCTCCTTAGGCTNNNNNNNTTTCCTC
TTCGACATGGTGGACCGAGGCGACGAGGGATCGAGGCGCCTTCTCC
page-top