Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35786  (registered. 2012)
Contig Information
Length 800 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218187002|gb|EEC69429.1|| hypothetical protein OsI_38596 [Oryza sativa Indica Group]
Score 446
Evalue 2.00E-123
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35786
TGGCACGGGCGTCCTCGTCCAAGACGGACAAGGCCCGGAAGGACAGCCCTCCCCCACCGCCCAGCCGGCTGCGGGCCTCGGCCCGGACTGACAGGTCTGC
CACCAAGAGCGCACTCGACGAGCTGCGAGCCAAGAGGATGAGGCAGCAGGATCCGGAGGCGTACCGTAGCAGGTTCAAGGATCTGGTTCCCAAGAGTGGC
AGCTCGCCTAATAGACGCAGGGCTGGAACCCCCCCGAGCGATGGTAGCAATGATGGCGGTCACAGGGGGAGGATGAACAACCATGTTGGGATTGCTGAGG
ATAATCGGGATGATGAGTTTGACGAATCACCAAGTAGACTTGACCCTCTCAAGTTTGATGATGTGAAGAGCATAACCCTTCGGAGGTCAAAGCTGGTGAA
GTGGTTCATGGAACCCTTTTTTGAGGACCTTGTATCTGGTTGCTTTGTGCGGCTTGGGATTGGCAAGACAAAATCAGGCACCCCCAAGTACAGGCTGTGC
ATAGTTAGAAACGTGGATGCTAACGACCCAGATCGGCAGTACAAACTGGAGAGTTACGAAACATGCAAGTATCTCAATGTTGTATGGGATAATGAAGCTA
ATGCTGCTCGGTGGCAGATGACTCAGGTCTCCGACTCTCCTGTCCTTGAAGAAGAGTTCAAGGAGTGGCTTCAAGAGGCTGAAAAGAATGGCGTACGCAT
ACCAACCCGGCAGGAAGTGCTGGAGAAGAAAGAAGCCATTATAGAGGCCTACAATTTTGTGTATTCAGCAGCTACTGTACAGCGGATGCTGAAAGAGAAA
page-top