Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35785  (registered. 2012)
Contig Information
Length 664 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|258598734|gb|ACV83439.1|| QM-like protein [Zea mays]
Score 380
Evalue 8.00E-104
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35785
CCCCGGGCTGCAGGAATTCGGCACGAGGCTCCCGCCGCCGCCGCAGCCGCCGCCTGCCTCGAGCCGCCGTCGCCATGGGGAGAAGACCTGCGAGGTGCTA
TCGGCAGATCAAGAACAAGCCATACCCCAAGTCAAGGTACTGCCGTGGTGTGCCTGACCCTAAGATCAGGATCTATGATGTCGGCATGAAGAAGAAGGGT
GTCGATGAGTTCTCTCACTGTGTTCACCTTGTCTCATGGGAGAAGGAGAATGTGTCCAGTGAGGCTCTTGAGGCTGCCCGTATTGCTTGCAACAAGTACA
TGACTAAGCATGCAGGAAAGGATGCCTTCCACCTCAGGGTCAGGGTTCACCCGTTCCATGTGCTCCGTATCAACAAGATGCTTTCGTGTGCCGGGGCTGA
TAGGCTCCAGACTGGTATGAGGGGTGCTTTCGGGAAGCCGCAGGGAGTCTGTGCCCGTGTTGCCATTGGGCAGGTCCTCCTTTCTGTGCGGTGCAAGCCC
AACAATGCCATCCATGCTACTGAGGCCCTTCGTCGTGCCAAGTTCAAGTTCCCTGGNNNNNNAAAGATCATTGAGAGCAGGAAGTGGGGCTTCACCAAGT
TCAACCGCAATGNNNNNNTCAAGTTCAAGAGTGAGGGCAGGATCTTGCCTGATGGAGTCAACGC
page-top