Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35771  (registered. 2012)
Contig Information
Length 874 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VHS Shoot with heat shock treatment 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 6
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|132099|sp|P26667.1|RBS2_WHEAT|RBS2_WHEAT RecName: Full=Ribulose bisphosphate carboxylase small chain PW9,"
Score 352
Evalue 3.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35771
GCTATCGCCTCCCACCTAGCAATTCACGTACTCCACCATGGCCCCAGCCGTGATGGCTTCTTCCGCCACCACCGTCGCGCCCTTCCAGGGGCTTAAGTCG
ACCACCGGCCTTCCCATCAGCCGCCCCTCCGGCAGCGCCGGCCTCAGCAACGTCAGCAATGGCGGAAGGATCAGATGCATGCAGGTGTGGCCGATTGAGG
GCATCAAGAAGTTCGAGACCCTGTCTTACTTGCCACCCCTCTCCACGGAGGCCCTCCTTAAGCAGGTCGACTACCTGATCCGCTCCAAGTGGGTGCCCTG
CCTTGAGTTCAGCAAGGTTGGCTTCGTCTTCCGTGAGCACAACAGCTCCCCAGGGTACTACGACGGTCGATACTGGACAATGTGGAAGCTTCCTATGTTC
GGGTGCACTGACGCCACGCAGGTGCTCAACGAGGTGGAGGAGGTCAAGAAGGAGTACCCTGACGCCTATGTCCGCGTCATTGGTTTCGACAACATGCGCC
AGGTGCAGTGCGTCAGCTTCATTGCCTTCAGGCCACCAGGCTGCGAGGAATCCGGCAAGGCCTAAAGTGCAAGTCCGATATACACTACAAGAATCTTGTT
AATCCATGACGGATACAGTCTGTCATGGAACAGTGCAAAACCGTCAAGGAGGGTTGTCCGTGACGGATTTATAATCCGTCATGTATATCGCGTCATAATT
TGACAACTGTACCACCATGACTGATCCTGGCCGTCACCGATCAGTCCCTAGGCCCGCCCAGGCCCGGTCCTCTATGACAGACTAGTCCGTCATGGATTTG
GAGACGCTATACAAAAATGGGCTTGACGTGGCATCTACATGGCACCAGCGTGAATGTGACGTGGCATCCACTTT
page-top