Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig357  (registered. 2012)
Contig Information
Length 896 bp
Clones alternative view 75 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 10
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 4
Wh_r Root 2
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 5
Wh_EM Dormant seed with water absorption 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 4
Wh_VSCB Liquid cultured tissue 8
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 9
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115466028|ref|NP_001056613.1|| Os06g0115500 [Oryza sativa (japonica cultivar-group)]
Score 392
Evalue 3.00E-107
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig357
GAATTCGGCACGAGGCGCAAAACCCTAGCCTTTCCCCGCGCCGCCCCCGCCGCCGCCCCGTCGTCCCCAGGTAAGGAGGAGGGCGAGATGGTGAAGCACA
ACAACGTCATCCCCAACGGCCACTTCAAGAAGCACTGGCAGAACTATGTCAAGACGTGGTTCAACCAGCCCGCCCGCAAGCAGAGGCGCCGCATCGCTCG
CCAGAAGAAGGCTGTGAAGATCTTCCCCCGTCCTACCTCTGGACCTCTTCGCCCCATTGTGCAATGCCAGACCCGCAAGTACAACATGAAGGCCAGGGCT
GGCAGGGGATTTACCCTTGAGGAGCTTAAGTCCGCTGGCATCCCAAAGAAGCTCGCTCCGACCATTGGCATTTCTGTGGACCACCGCCGCAAGAACAGGT
CGCTTGAGGGTATGCAGTCCAACATCCAGAGGCTCAAGACCTACAAGGCCAAGCTTGTCATCTTCCCAAGGCGTGCTCGCAAGGTCAAGGCTGGTGACTC
TACTCCGGAGGAGCTTGCCAATGCCACACAGGTCCAGGGCGACTACATGCCCATTGCCCGTGGCGAGAAGCGCTCAGTCGAGGTCATGAAGGTCACAGAG
GAGATGAAGGAGTTCAAGGCCTATGGCAAGCTCCGCGTCGAGAGGATGAACCAGCGCCAGTTGGGAGCCAGGCAGAAGAAGGCTGCCGAGGCGGAGAAGG
AGGAGAAGAAGTGATGAGATATGCTTAAGGCAGCTAGTGGGTTCTGTTGTTATCAAGTGCTAGTTTCTAAATTTGTGTTTTGGCCTTCTCGGACATCTTG
TTTGATACCTGATATACTTATTTGCATGATCTGCTATCAAATCTTATCCTATGAGTGTCCTTGGATTTTTATCCTTGTGTCTCTTATCAAAAAAAA
page-top