Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35681  (registered. 2012)
Contig Information
Length 874 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|238014088|gb|ACR38079.1|| unknown [Zea mays]
Score 377
Evalue 9.00E-103
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35681
AAATAAATAAATCTGGCGCAGGTGCTGGGAGGAGGACGACGCACGCACCGTCACAAGCAGCTCAATCTCTTTCTCCTTTTCTTTTCTCTGCCCCCTCCCT
TATCCCCACGCCCAGGAAACGCGTCTCCGGAGGAGGAAGGGAAGATTTCATCTTTTTTGCCCCCAAGATGTCCTCCCCAAGCAAGCGCCGCGAGATGGAC
CTCATGAAGCTGATGATGAGCGACTATAAGGTGGAGATGGTGAACGATGGGATGCAAGAATTCTTCGTGGAATTCCGAGGGCCTACTGAAAGTATTTATC
AAGGTGGTGTCTGGAAGGTTAGAGTAGAACTGCCTGATGCATATCCTTACAAATCTCCGTCAATTGGTTTCATTAATAAGATTTATCACCCGAATGTGGA
TGAAATGTCTGGTTCCGTATGTTTAGATGTTATTAACCAGACATGGAGCCCAATGTTTGATCTAGTAAATGTGTTCGAAGTCTTCCTTCCACAACTTCTG
TTGTACCCAAATCCGTCTGATCCATTAAATGGAGAGGCTGCTGCACTTATGATGCGAGATCACCCTGCTTATGAACAAAAAGTGAAAGAATTTTGTGAAA
AATATGCGAAACCAGAGGATGCTGGCATAACCCCAGAAGACAAGTCCAGTGATGAAGAGGAGCTTAGCGAAGACGAAGATGACTCCGGTGATGAGGATAT
AGTGGGCAAACCAGATCCTTAGTCACTACCACAACCCGTTGTATACAATGTTGGTTGCAAAATTTGCAATCAAATTGATCCAGAAAATCTGGGAAAGAGA
ACTTTGTATGTCATGTAAATAAGTGTACTTGTATCTTATCCAATGTTGTTTTCTTCAGTTGACCAAAAAAAAAA
page-top