Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35653  (registered. 2012)
Contig Information
Length 1891 bp
Clones alternative view 44 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_yd Spikelet at late flowering 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_PCDAM Anther at meiosis 2
Wh_VHS Shoot with heat shock treatment 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 3
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 16
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|2493132|sp|Q40079.1|VATB2_HORVU|VATB2_HORVU RecName: Full=V-type proton ATPase subunit B 2; Short=V-ATPase
Score 948
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35653
TCCCTCTCGTTCTCCATCTCGTTACCTCTCTGCTGCCAACCCGACCTAAGGTTGTTCGTCGCCAGCATGGGTCTGGCGAAGGATGGCGCCGAGATGGAGG
AGGGGACATTGGAGATTGGCATAGAGTATAGAACTGTCTCCGGTGTGGCAGGGCCATTGGTTATTTTGGACAAAGTAAAGGGCCCAAAGTATCAGGAGAT
TGTGAACATCCGATTGGGAGATGGCACCACTCGTCGTGGTCAAGTCCTCGAAGTTGATGGTGAAAAAGCTGTTGTGCAGGTATTTGAAGGTACTTCAGGG
ATAGACAACAAGTATACTACTGTACAGTTCACAGGCGAGGTTTTGAAAACTCCCGTCTCACTTGATATGCTTGGACGCATTTTTAATGGTTCTGGAAAAC
CTATTGATAATGGCCCCCCTATATTGCCTGAGGCTTACTTGGATATTTCTGGAAGTTCTATCAACCCAAGTGAGAGAACCTATCCAGAAGAGATGATTCA
AACAGGAATATCCACCATTGATGTCATGAACTCGATTGCTCGAGGGCAAAAAATTCCTCTTTTCTCTGCTGCTGGACTTCCTCATAATGAAATTGCTGCT
CAAATTTGTCGCCAAGCTGGCCTCGTTAAAAGGTTGGAGCAAAGCAAGCATGCAGCAGAGGGAGGTGAAGAAGACAATTTTGCAATTGTGTTTGCTGCTA
TGGGAGTAAACATGGAAACGGCACAATTTTTCAAGCGTGACTTCGAAGAAAATGGTTCGATGGAGCGGGTCACCCTTTTCCTGAATTTGGCAAATGACCC
CACTATTGAGCGTATTATCACTCCTCGAATTGCCCTAACAACTGCTGAATATTTGGCATATGAATGTGGGAAGCATGTTCTTGTGATTCTGACAGATATG
AGCTCATATGCCGATGCACTTCGCGAGGTCTCAGCAGCACGAGAAGAGGTACCTGGTAGGCGTGGTTATCCTGGGTATATGTATACTGATTTGGCCACCA
TATATGAGCGAGCTGGGCGTATCGAGGGAAGGAAAGGATCAATTACCCAAATTCCTATTCTTACAATGCCTAATGATGATATCACTCATCCAACTCCTGA
TCTTACGGGATACATTACCGAAGGGCAGATATATATTGACAGACAGCTTCATAATAGACAGATATACCCACCCATCAACGTCCTGCCATCTCTTTCTCGT
CTGATGAAGAGTGCTATTGGTGAAGGTATGACACGCCGGGATCATTCAGATGTGTCCAATCAGCTGTATGCCAACTACGCCATTGGGAAGGATGTTCAAG
CCATGAAAGCAGTTGTCGGAGAGGAGGCTCTTTCATCTGAGGACCTGCTCTATTTAGAATTCCTTGACAAGTTTGAGAGGAAATTTGTAGCGCAAGGAGC
ATACGATACTCGGAACATTTTTCAGTCACTTGATCTGGCATGGACATTGCTACGCATATTCCCCCGAGAACTTCTCCACCGTATTCCTGCGAAGACCTTG
GATCAGTTCTACAGCAGAGATGCCACCCATTGATCCATTTTGTTCATAAAAATTCATTTTTTTTCATGATGAACAGCTTGAATAAGAGAAGAACCCAAAC
TTGTATCATTTTCCTACGTTATAGTCAGATCCTATTCTTTCCAGTCTGTATGCACAAGTTGTACCCACATGTCTTGTGCACTGGCAGCTTTGTAATTCCA
TGTAGCCTCCATTCACAAGCTAGACCTCTTTCTGGTTTCATTTCCCTGTATTCTGCAGCAAAACTGAAAAGCACGCCTACATGCCTGAAGATGTTGGTTA
TATATTTTTGGACTTCTGGAAAATGTAAACAATATTGATTTGTTATTTGTCAAGGATTTGAAGTAAATTGATTGATACAAGAAAAAAAAAA
page-top