Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35641  (registered. 2012)
Contig Information
Length 1774 bp
Clones alternative view 166 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 10
Wh_r Root 1
Wh_SH - 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 6
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Wh_V4816 Shoot grown under cold condition for 16days 6
Wh_V483 Shoot grown under cold condition for 3days 7
Wh_VABA Shoot with ABA treatment 32
Wh_VHS Shoot with heat shock treatment 14
Wh_VWD Shoot grown with dessication 14
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 13
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 8
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 7
WH_XN Leaves, plant was grown at constant 23Ž 4
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 13
WH_SP 2
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115484401|ref|NP_001065862.1|| Os11g0171300 [Oryza sativa (japonica cultivar-group)]
Score 714
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35641
TGACGTGCATCTCGCATGGGCGGCAATCAAACTTTAGCGTTAATACTTCATCGCCGTTAACCAGTTGCATTGGCGTCGCCTTCCAGCTTTTGATATTGCC
TTTCGCCTGTTTCGGGCACAGATTAAAGGCAAAGCGCAGACAATGCTTGGTGATCATCACCGGGACTTCGCCCTTCTCTTCATGTGCTTCGAGAGAGAGA
GAGAGAGGATAGCTAGCACCTTGAGCTTGAGGTCAGTGGCAGGCAGGCAAGCAAGAAAGTAAGAAGAAGAAGAAGAAAGGACATGGCATCTGCTACTCTC
CTCAAGTCCTCCTTCCTCCCCAAGAAGGCCGAATGGGGCGTCGCGCGCCAGGTCGCCGCCCCGAGGGTGTCCATGGTCGTCCGCGCCGGCGCCTACGACG
ATGAGCTCGTCAAGACCGCGAAAACCATCGCGTCGCCGGGGCGCGGCATCCTGGCCATGGACGAGTCCAACGCCACCTGCGGGAAGCGCCTCGACTCGAT
CGGCCTGGAGAACACAGAGGCGAACCGGCAGGCGTTCCGCACGCTGCTGGTCTCCGTCCCTGGCCTCGGCAACCACATCTCCGGCGCCATCCTCTTCGAG
GAGACGCTCTACCAGTCCACCGTCGACGGCAAGAAGATCGTCGACATCCTGGTGGAGCAGGGCATCGTGCCCGGGATCAAGGTGGACAAGGGCCTGGTGC
CGCTCACCGGCTCCAACGACGAGTCTTGGTGCCAGGGTCTCGACGGCCTCGCCTCCCGGGAGGCCGCCTACTACCAGCAGGGCGCCCGCTTCGCCAAGTG
GCGCACCGTGGTCAGCATCCCCAACGGCCCCTCCGAGCTGGCTGTCAAGGAGGCCGCATGGGGCCTCGCCCGCTACGCCGCCATCTCGCAGGACAACGGT
CTGGTGCCCATCGTGGAGCCGGAGATCCTGCTGGACGGGGAGCACGGCATCGAGCGCACCTTCGAGGTGGCGCAGAAGGTGTGGGCCGAGACCTTCTACC
AGATGGCCCAGAACAACGTCATGTTCGAGGGCATCTTGCTCAAACCCAGCATGGTCACCCCCGGCGCCGAGTGCAAGGACAGGGCCACGCCGGAGCAGGT
CGCCGACTACACCCTCAAGCTCCTCAGCCGCCGCGTGCCGCCCGCCGTCCCCGGCATTATGTTCCTGTCGGGAGGGCAGTCCGAGGTGGAGGCCACGCTC
AACCTCAACGCCATGAACCAGGGGCCCAACCCGTGGCACGTCTCCTTCTCCTACGCCAGGGCGCTGCAGAACACGTGCCTCAAGACGTGGGGCGGCCGGC
CGGAGAACGTCAAGGCGGCGCAGGAGGCGCTGCTGCTGCGTGCCAAGGCCAACTCACTCGCGCAGCTCGGAAAGTACACCAGCGACGGCGAAGCCGCCGA
GGCCAAGGAGGGCATGTTCGTCAAGAACTACAGCTACTAATCCAACCATTCCAATCAACACTACTACGTACGTTCGTTACGAAAGCAGAAATTAAAGATG
CATGCATGCATGCATGATGATACAGCTGCAAGTGCAAGATCGATCGAGCTCGGAGCCTGAGCCTGAGATGATGATTACTTGTATTTTCTAGATCTTTTTT
TACTCGTTAATTTGCCTCTCGATATGCACAATTCATGCTACAGTCCAGTAGATTATTGTAAAGCTACTTTTACGTGTGCGATCCATGGATTTGCATGGTT
ACTGCAAAATTTTGCATGTACATACGTACACCATGAATTTACGTGTGCGTTTGTTGGTTCGTCTAAAAAAAAAA
page-top