Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35628  (registered. 2012)
Contig Information
Length 1000 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_SH - 2
Wh_VHS Shoot with heat shock treatment 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XF Seedling, infected with leaf rust 2
WH_XV Leaves, plant was grown at constant 23 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115455773|ref|NP_001051487.1|| Os03g0786100 [Oryza sativa (japonica cultivar-group)]
Score 322
Evalue 3.00E-86
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35628
AGAGCGGTGAGCTGCTACCTGCGACGATGGATGTGGCTGGGGAGGGCGGCAGCCGCCAGGCGAGCGGCGATGCTCGCGGGGCTGGGACCCTTTCCAGTTC
ACACCCGTATCCAGATAAGCTTTACTCGATGACAATGTATTATGATAAATACAGAATCGATGAGTGTATATGTGTGGACCCAATAGGATATGGAATACAA
TATGGTGTAGTCGGTGTGAAATATGGTCAAATGGCGAAACGTGCCGGTCGACAGTACGCAAAATTTATCTACTACGGCTCACCGTCCCCGGCCGGACACA
CACGGCTAGCATCCATCTTGGCGCTGACGATGTCGTAGGTATAGAGTTCGCGGTAATTATTGCGTGCGTTGCAGTGGATACTTGGCTAGCATGCCCGGCC
GTGCGTCAGAGACGGCGATGATCGGCGGTGGGCGCGTTCGTATGCCGTTGGCTCTTGATCACATCCTCGGCAGGGGGCGCCCGAGGCGGTCGCCCTCGGT
GAAGATGTGGTTGCGGGTGATGTCGCTGAGCTTGGTGCACCCGCCGAGCGCCATGGTGAGCTCGAACTCCTCCCGCATCATGCGCAGCACGTTCCGCACT
CCGGCCTCGCCCTCCGCCGCCAGCGCGAACACCACCGGCCGCCCGATGAAGACGCCGGAGGCGCCGAGAGCGAGCGCCTTGAAGACGTCGGTGCCGCGGC
GGACGCCTCCGTCGAGGTACACCGGGATGCGCCCCTGGGCGGCCGTGACGACCTCCTCGAGGGCGCTGATGGTGGCCGGCACGTAGTCGAGCTGGCGGGC
GCCGTGGTTGGACACGATGATGCCGGCCGCGCCGGAGTGGACGGCCAGCCGAGCGTCTTCCGCGGTGATGACTCCCTTGACGAGGATGGGCATGGTGGTG
ATGCTCTGCAGCCACTTGACGTCCTTCCAGCTCAGGGTGCGGTCGATTTGGCCGGCGACGTACGACGCCAGCCCGGAGTCATTGGCCTGGTCCATGGTGC
page-top