Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35624  (registered. 2012)
Contig Information
Length 688 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_VABA Shoot with ABA treatment 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222629694|gb|EEE61826.1|| hypothetical protein OsJ_16466 [Oryza sativa Japonica Group]
Score 369
Evalue 2.00E-100
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35624
CATATCATACACGTTGTACAAGGGAGCGCATGACACCCCCAACCGTGGAATGTATTTAAGGTTCCTCCCGTAGTAATCACGGTTGTGAAAACAGCAGAGA
GGGTCGTCTACTTCTTTCTCCTATAAATCTTCTTCAGAAAGATCTTCAAAATCTCCCGAATCGCACGGTCTGGCTCGGCGTCGATGGTTGAAACTAGGTG
CTTGTAAACTCTTGACTCGTACTCCAAGAATATGTCCTGGAGATCAAGCTCCTTATAAACATTTTTCACTGCTGCAACACATTCCGGGCAAGACTTGCCA
TAGTTTTCATATAGTATTTTCATCTCATTCTCATTAGCCAGTTCCATAGCCTGGACAATTAGCCAGGAGCACTTGTAGTCTTCTATGTCTGTTCCAACCT
TGCCAATAACTTGAGGGTCGCCGAAGCAATCGAGGTAGTCGTCCTGTATCTGAAAGTAGACTCCCATCTCAATCAGTACATTTTTGAGCTCGACGTAGTC
GCTCAGTTTCGCGCCATTCAAGAGCAATGCACAGGCAACCGGCAGGTAGAAGGAATAGTAGGATGTCTTGTACTTGACAATGCGGCGGTACCCTTGGATC
CTGTATCTGGCGAGATCCTTGGCGCCGGTGTGGGTGGTGATGAGGTCCAGCATCTGCCCCATGGCGGTCTGCAACCCAATCTCGTTCC
page-top