Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3562  (registered. 2012)
Contig Information
Length 1622 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_oh Pistil at heading date 3
Wh_DPA20 Seed DPA20 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242064454|ref|XP_002453516.1|| hypothetical protein SORBIDRAFT_04g007170 [Sorghum bicolor]
Score 787
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3562
ACAATGAAGAATGGCTTCTCTAGAAATAACATTTGCAACATTCAAGTAAAACAACACACCATTGCGGTCACCGTTCTCAGCACAGCAAGGCTAACCAATC
TAGTCGACAAAGCAACATACATTACAAGCAAACGAACGGTTCCCATCTCATAATAACCCAATAAAGAAATTTAACCCTGAAGAGGCAGCTGCAAGGCACT
GCAAGTTACAGTTGTCGACGCGGTTCATGAAACCCGCAGCTCATCTGGCAAATGTGCCGCTATAAGTTTAAACCACCGATACATGCCGGCAAAAGCTGAG
ATGCTAAAACGAGGGCCTCACTTCCATAGCTTCCGCAGTGACATGTTCTTCTCGGTATCCTTCTTCATCACCTTCGCCACGGCCATCTCGAAATCCTCCT
GGGTGACGTGCACCCTTCTCTCGCGGAGGGCAAACATTCCAGCTTCTGTGCAGACCGCCTTTAGCTCTGCTCCTGATGCACCGTTCATCTTCTCAGCAAT
TTTTTTCAGATCAATGCCACGCATCAAGTTCATTTTTCTTGAATGAATCTTCAAAATATCACCACGGGAATCTGCATTAGGATTTGGAAATTCGATCTTC
CTATCGATACGACCAGGCCTCAGAAGAGCTTGATCCAATATGTCTATCCTATTTGTTGCCATAAGAACCTTAATTTTGTTCGATGCTTCAAAACCATCAA
GTTGGTTCAGAAGCTCAAGCATTGTACGCTGAACCTCGCTATCACCGTTGCCGGATCCCGACTCCATTCTAGCAGATCCAATAGAGTCTATTTCATCCAT
AAATATAATGGATGGTGCATGCTCCCTAGCCATCACAAAGAGTTCACGAACCATCCGGGAACCCTCTCCAATATACTTCTGAACCAACTCAGACCCTGAC
ACCCTGATGAAGGTGCAGTCCGTGTGATGAGCAACTGCACGAGCAAGTAATGTTTTCCCTGTACCTGGAGGCCCGTAAAGAAGGACACCCTTTGGTTGGG
CAATTCCAAGACTCTCAAACAGCTCAGGATGCTTGATGGGAAGCTCAATCACCTCCTTGATCTCTTTAATTTGCTGGTCAAGACCACCAATCATATCATA
GGTAGAGTCAGGAACCTTCTCCACCTTCATAAGATTAACCAGTGGATCGACTTTGCTGGGCAGGATAAGGTGAAGCATGTAGCTGTCGTTCCGAAGAGCA
ACTCTTGTTGAAGGGGTTATCTTTGTAATATCAATACTTTTATCAAGATCTACAACATATTTGCCTTCTGGATGAACCTTGACTAGAACCTTTGACTTGC
CCATAACCTTCACAACCTCGCCAACATATGAGCCCGGTTCTTGAAGAAGCTGCAACTCTTCCCGAAGCATTCTAACTCGAGAGTTGAGGTCGTTGCGCTG
GGCCTCGAGGCGGTTGAGGTTGTGCGTCTTGGTCCGGATCTGGAGCTGCAGGTCGTGGATGTGCTGCAGGTAGTACTGGCGCAGCCCCTCCCCGCCGCCG
GCCCTGCCCTTGGCCGACGCCGCCGACGGGTCGTCGACGCTCGCCGGCAGCGCCGAGGGCTTCGCGATGTCCATCGCCACCGCCGCCATCGGGATTCCCC
CTCGTCTGCTCCGCCGCTCTGG
page-top