Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35578  (registered. 2012)
Contig Information
Length 886 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
WH_XN Leaves, plant was grown at constant 23℃ 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115445103|ref|NP_001046331.1|| Os02g0223700 [Oryza sativa (japonica cultivar-group)]
Score 200
Evalue 2.00E-49
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35578
GAAGGAAAGGATCCGTATGTACAAGGACAACACAGGCAAGCTTCTCTCGGTGGCCAACAAGAAGGACACCAGGAGAAGCGCCGCTCACACTACTGTACGT
ATGCCACACAAACAAACCGTCAAAAATCCTACTACAAGAAGATGAAAGAAAAAGGAGGAAGCAGAAGGGCAGAGAAGATCAAGACGCGCGCGCTCATACG
TACTGTACTACTGTATAGCTCAGCTGCACAACAAGTCGTACCGGGAGCAGACGGAGGCAGAGCAACCTGGATGGACGGATCGCCGGCTCATCACCAGCCG
TAGACGGCGCGGGAGCACTTGACCTTGATCCACTTGACGCTGCGCCGCACCGACCCCTTCACCTTGCCCTCCACGTCGTACACCTTGTAGGCCACCAGCC
GCTTCTTCCTCTGCAGCTCCGCCTCCGCCTCGTCCGTCTTGGCCGGGGCCGGGGCCGGGGCCTCGTTGTCCACCAATGCCGAGAAGGAGGGGGTGTAGCT
CCTCAGGTTGAGGGAGCGGCGGCCGGTGGAGGACCAGGTGGCTGCGGTGGTGGTGGCGGCGTTGGGCCCCTTGGCCTGGGCGGCGCCGTCGGAGAAAGGC
TTGTAGGAGGCCGCGTAGGAGGCGCTGTAGCACCGGAGGTTCAGCCCCGGGGTGGGGCCGGCGCCGGAGACGGTCCTCGTGCTGCCGCTCCGCTGCACGG
CGGTCGCCGCCACGGGGCGCGACAGGGAGGTGGTGCTCCTGGCGCGCTGCACCTTGGTGGGCGCGTAGGAGACGGCGTAGGAGGCGCTGTGGCACCGGAG
GTCGTTGGCCGGCGCGGCGGCGGCGGCGGTGCTCCTCTCGGCCAGCGACACCGACCTCTCCATTGGCATCTTGTACCGCTCCGCCT
page-top