Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig355  (registered. 2012)
Contig Information
Length 831 bp
Clones alternative view 53 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 6
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 1
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 5
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_SP 6
WH_XB Root 4
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|14585879|gb|AAK67641.1|| ribosomal protein L15 [Homo sapiens]
Score 422
Evalue 2.00E-116
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig355
GAATTCGGCACGAGGCACTCCCGCTTCCCGCCGCCTACGCCCTCTGCCGCCGCAGCCGCAGCCATGGGCGCGTACAAGTTCGTGTCGGAGCTATGGAGGA
GGAAGCAGTCCGACGTGATGAGGTTCGTGCAGCGCGTGCGTTGCTGGGAGTACAGACAGCAGCCCGCCATCGTCCGCATCACCAGGCCCACCCGCCCCGA
CAGGGCACGCCGTCTCGGCTTCAAGGCCAAGCAGGGGTATGTGGTCTACCGTATCCGTGTGAGACGTGGTGGCAGGAAGCGCCCAGTGCCCAAGGGTATT
GTTTATGGCAAGCCCAAGCACCAGGGTATTACCCAACTTAAGTTCCAGAGGAACAAGAGGTCTGTTGCGGAGGAAAGAGCTGGGCGCAGGCTTGGTGGCC
TTCGTGTACTCAACTCCTACTGGGTGAATGAGGACTCCACCTACAAGTACTTTGAGGTCATCCTTGTTGATGTTGCTCACAGCGCTGTCCGCAATGATCC
AAGGATCAACTGGCTCTGCAAGCCTGTGCACAAGCACCGTGAGCTGCGTGGTCTCACCTCTGCAGGAAAGAAATTCCGTGGTCTGCGTGGCAAGGGTCAC
CGCCACCACAAGAACAGGCCCTCAAGGAGAGCCACCTGGAAGAGGAACCAGACCGTGTCCCTCCGCCGCTACCGTTAAGCTTGTGTGTTGTTATGTTCCG
TGGAACCTGTCCTATGCCTACCTCGACAGTATCTGTTTGCGCCGTCAAATTTTGCTACCTTCGTTCTGTGGATGAACCTTTTATGTCCAGGCATGTCTGT
TGAACTATTTGCTACGTGCCTGTGTTACCTG
page-top