Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35462  (registered. 2012)
Contig Information
Length 833 bp
Clones alternative view 38 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_SHDr Shoot grown with dessication 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 8
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 8
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|29367419|gb|AAO72582.1|| unknown [Oryza sativa Japonica Group]
Score 272
Evalue 3.00E-71
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35462
TTTTTTTTTTAGATCACTGGTCAATGTGATTAGAGAGTTCAGCGTGTATAGTTCCAAAACAGGATCCGGAACGCTTTCAGACCGAACAGATTAGGTCACA
GTTCATGGCAATGCAAGTTACAAGATCATAGCCTGGTTAACAGTAGAAACTTGCAAGATCCTATCCATGTTTTATTTACCTGCTTTCCGCAGTTTCGGAT
CAGGGAAATTCATCCACACAACTTCGAGAGAACGGATTCTGGAACCTAATCATTATTATGCATTTGTTTAAACAAGTTCATCCAGATGACTCGAGAACTG
GCCGGATTCAGGAGGAGGCAGGAGTGAACTTGATGGAAACGCTGTTGACGCAGTGGCGCTCATCGGTAGGCGTCTTGAAGCCTTCTCCCTTGAACACATG
TCCCAAATGCCCGCCGCAAGATGCGCATGTGATCTCTACCCTCCTACCATCAGGGTCAGGCGTCCTGTGTATGGCTCCAGGGAGCCCCTCGAAGAAGGCC
GGCCAGCCACAGCCGGAGTCGAATTTGGTGGTGGACTTGTACAGGGGCGTTCCGCAGCCAACGCAGTTGTACGCCCCGTCACCGTAGAACTTGTTGTACT
CGCCTGTTCCCGGTAACTCGGTGCCCTTGAGGCGGAGGATGCGGAACTGCTCGGGGGAGAGGACGGCACGCCACTCCTCCTCGCTCCTCGGCTTGCTGTC
GCCGGACGCCATCGGTCGCGCTCGCGCGCGCGGCGAACGCAGGGAGGACGAAGCCGGCGGAGCGCCGAGGAGGGAGGCAGGGAGGGAGGGGAGGATCGAG
AGCAGAGGAGGGGAAGAGGATAGCGGAGACTTT
page-top