Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig3545  (registered. 2012)
Contig Information
Length 918 bp
Clones alternative view 66 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 3
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 3
Wh_CSEC Callus 9
Wh_DPA20 Seed DPA20 1
Wh_EM Dormant seed with water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 3
WH_XA Root 2
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 3
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125597641|gb|EAZ37421.1|| hypothetical protein OsJ_21756 [Oryza sativa Japonica Group]
Score 462
Evalue 2.00E-128
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig3545
GCTGCAGGAATTAGGCTCGCCCGCTGAGGTTTCCGCCGCGATCTCGTCTCGATCCGCACTCTCTATCTGAGATTTGGAATCGGGCGAGGCCTGCAGCTCC
TGCCGACATGGCGCTCGTTTTGCATTCGGGCAGTGGCAACAAGAATGCCTTCAAGGCACTTATTGCTGCAGAGTACTGTGGGGTCAAGGTTGAGCTGACC
AAGAACTTTGAGATGGGTGTCTCAAACAAAACCCCTGAATTCATCAAGATGAATCCCCTTGGCAAGGTTCCTGTTCTTGAGACTCCTGATGGTGCTGTTT
TTGAGAGCAATGCTATTGCACGCTATGTTGCTCGCTCAAAGGGTGACAACCTGCTTTGGGGTGGTTCTCTTATTGAATATGCGCGTGTTGAGCAATGGAT
GGACTTTGGTGCCACAGAGGTTGATCCCAATATCGCAAGGTGGCTGTACCCAAGGCTTGGTTATATGCCTTACAATGCCCAGTCTGAGGAATTCGGCATT
GCTGGATTGAAGAGGGCCCTTGAAGCATTGAACACACACCTGGCATCAAACACATTCCTTGTTGGGCATTCTGTCACTCTGGCTGATATTGTCATGACAT
GCAACCTCTACCATGGTTTTGCTCGGATCTTGACCAAGACTTTCACATCTGAGTTCCCTCATGTTGAGAGGTACTTCTGGACCATGGTTAACCAGCCTAA
CTTCAAGAAGGTCATTGGCGATTTCAAGCAGGCAGAGGTTGTACCTCCTGTTCAGAAGAAGGCTGCTCCTGCTAAACCAAAGGAGGCCAAGAAAGAGGCT
CCCAAGGCGGCCCCAAAGCCAGCAGAGGTTGAGGCACCAGAGGAAGAGGCACCAAAGCCAAAGCCCAAAAATCCCCTTGATCTACTGCCACCAAGCAAGA
TGGTACTTGATGACTGGA
page-top