Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35367  (registered. 2012)
Contig Information
Length 875 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 1
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 8
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115441775|ref|NP_001045167.1|| Os01g0913000 [Oryza sativa (japonica cultivar-group)]
Score 279
Evalue 3.00E-73
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35367
CTCTGTAGACCACCAACTCACACCACCCGTTGAGGGCGTTACCTTCCAAAACTCCTGCATCCAATGGCGTTACGCCTCTCCGTCTCCTCGCCGCAGAGCA
CGGCCTCGTCGCCGGCCATCTCCTCATGCCGCCCCGCCGCCTGCGGCCGCTTCCTGGCCTGCGTGGCGGCTTCTCAGAAGAGGAGCCTGATGGTGGTGTC
TGGCGCTGACGCGAGGGCAGTGGCTCCGGTGAAGTCGGGCGGCTTGGAGACGGCCACGACGGGAGCCGACGAGGTGGAAGCGCCCACAGCGGCGGTGGCG
GTGACCGGGCAGGTCACCGAGGTCTGCAAGGACACCTTCTGGCCAATTGTCAAGGCAGCAGGGGAGAAGCCCGTCGTCCTCGACATGTACACCCAATGGT
GCGGCCCTTGCAAAGTTATGGCACCAAAATTCCAGGAGATGTCTGAGAAGGACCACGACGTCGTATTCCTCAAGCTCGATTGCAATCAAGACAACAGGCC
ACTTGCAAAGGAGCTTGGTATAAGGGTTGTACCAACATTCAAGATTTTCAAGGATGGGAAGGTTGCAAAGGAGGTCACTGGTGCGAAGATTGATGAATTA
GCGCGTGCCATTGAGGAAGTGAAGTCAAGCTGAGCAATTCCCTGGAAAGAAATGCAGCAATTAGCATGCTATCACTAGTGTACACTATGGGATGAAAACA
GCCTTTGTGGAAGTGGATAATCACCGTGGAGAAAAACAGTTATTATAGTTCTGCTTATGATGATTTACCAATCGTTCTGGACAATATACACCCATCCATG
TGGAGTGTATGCTGTAAATAGTCATTTAAATCTTTCTGAGAATACGGTTGCTTCCTGATCTCACTAAAAAAAAAA
page-top