Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35257  (registered. 2012)
Contig Information
Length 1057 bp
Clones alternative view 66 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Wh_SH - 3
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 4
WH_XN Leaves, plant was grown at constant 23Ž 16
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XE Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 7
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 9
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115467478|ref|NP_001057338.1|| Os06g0264800 [Oryza sativa (japonica cultivar-group)]
Score 247
Evalue 1.00E-63
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35257
CTAAATAGGTGTGACTCAGCTTTGAGTCACTTACCCTGTACAATACAATACGAGTTTCATTTCATATTCATATAAAGTCAATTCGACGGATCACGTTTCC
CATATGAACACATTGATATAGAAAACAATAGAAGACTTCCAGAAACTGATACAATTTCACTATTGTCACCGCACACCAACCAAAGCATATTTCTTTGTTC
ATACAGATATGTATGTAACACACAAATGCAGTGGATGGTACTCTAAGCAAGTAGGTGTTCTTCCATTACATGGACAGACAAAAGAGCCATAAAAAACGTT
CCAGAGAACTTGAGTTTATTCTGTTCCGGCGATCTTCTTCTTCAAGCTCTCGATGTCGGTGGCCAACTCTTTCCTGCTTTCCTTGAAGAGGAGGTAGCGG
TACACGAACCACCCGGTGTAGCCGAGCCCAACCAGCTCCAGGAGCTTGGGGAGCAACGGCACGGAGTTGATGGCGCCGACGACGACGGTGGTGAGCCAGA
GAGCCACGACGGCGCCGCCGCTGTAGAGGAGGAAGGTGGGCTTGTCCTCAATCGCCTCCCACTTCCCTTTCAGGTCCTCGATGATCTCGTCGCCGCTAGC
CGACGTGTCGTCGGAGGCGGCCTTCACGCGGAGCAGGGACGGCCTGGGCGCATCTTGGAGGCGGAGCGGGTGGAGGTTGCGCCGCGGGAGGAGTGCGGAG
GAGCGGGGGGCGAGGTTGCCGGTGGCGGCGGGGAGGCGCGCCCCACCGAGGAGGGCCACGGAGTACGCCGTGGCAGCCATTGATCCGTCAGTGCCTTATC
GCTAGAGCTATCGCTTCCTCGGCCTCTCGCTCTGCGTTTCGCTGGTGCATTCGCATAAGGAGGGCCATCATGCAGAATGAAGGTTTTTTTGCCTTTTTTA
GCCGCACGGATGATGCCGTACAGATCATCATCAGTCCAACGCGCCAGCATTCCCGGTTCGCGCTTGGCGAGATCGCCACGCATCGGGAACCCTGTTTCCG
GCAAATTCAGGGTTGATTTATAGTCACTCATCAGATTCTCGGTTCCGTGTTTCGGTT
page-top