Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35254  (registered. 2012)
Contig Information
Length 793 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|12963338|gb|AAK11219.1|AF324485_1|AF324485_1 aminotransferase-like protein [Oryza sativa]
Score 459
Evalue 2.00E-127
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35254
GGAGATGGAGACTCCTCGTGGCCTACTCCAGTCAGATGCCTCGGCCGATCAGGTGGCTTCCGAACGGTCAGACTCTGTTCAACAACATGGGGTTGATAAG
GAGCATGCCATGCTGGCACCGTTCACAGCCGGATGGCAGACCGCAATCTCGCCGACATTGATTATCGAGAGATCTGAGGGCTGTTATATTTATGATGCCA
ACGGAAACAAGTATCTGGATGCCCTTGCAGGATTATTGTCTACAGCTTTAGGTGGTAGTGAGCCTCGATTAGTCAAAGCTGCAACAGAGCAATTGAACAA
GCTGCCTTTCTACCACTCCTTTTATAATCATACAACAAGACCCTCTTTGGATCTTGCGAACGAACTTATTAGCATTTTCACTGCCAGGCAAATGGGGAAA
GTGTTCTTTACCTGCAGTGGTTCGGAAGCAAATGACTCTCAGGTCAAGCTAGTATGGTATTATAACAATGCATTGGGGAGGCCAAAGAAGAAGAAAATCA
TTGCACGATCACAATCGTATCATGGGACAACATACATATCAGCTAGTCTATCTGGTCTTCCTACGTTGCACCAAGACTTTGATCTGCCAGGAAATTTTGT
TCTACACACAGACTGCCCTCACTACTGGCGTTTTCACCTCCCTGGTGAGACGGAAGAAGAATTTGCAACTAGACTTGCCAATAATTTAGAGAATCTTATC
CTCAAAGNNNNNCCAGACACGATTGCTGCCTTCATTGCTGAACCTGTGATTGGTGCTGGTGGTGTCATCCTGCCTCCAAAAACATATTTTGAG
page-top