Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35241  (registered. 2012)
Contig Information
Length 672 bp
Clones alternative view 47 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 13
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 6
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XE Seedling, infected with leaf rust 4
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XV Leaves, plant was grown at constant 23Ž 4
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|400879|sp|P31093.1|PSAN_HORVU|PSAN_HORVU RecName: Full=Photosystem I reaction center subunit N,"
Score 288
Evalue 3.00E-76
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35241
TACATGCTAACATGCATTTTTTTTTTTCCAGGTGAAAACAGAATTCCACTTGATGATGATAAAATTACAGCGACGATAACTTCACAGTTGAAACACTTGC
GCAGTTTGGACATCTAGGTACACGCGGTGCGCTGACATACATCAGCACTCGCCATATTGCCTGGCAGATCGACCAGCTTCACCATTTCCAGAAGACGTTG
GATCCGCACTTGAACTTCTCCTTCCCCTCGCACTCGATCTCCAGGTCGTCGGTGATGAACGGGACTTTCTTCTGCTTGGCGAGGTCCTGGCAGCCGGTGA
AGTTGTAGGGGAACTTGCAGCTGCCGAACTGGACGGTGTAGGCGCGCGCGAAGTTGGCGCCGCTCGTCGCCGCCCTCTTCTTGTCGTTCAGCTCCTTGTT
GAGCTTGCTCTTCTCGAGGTACTCGTCGAAGACGCTTGCCCTGGCCGACCCGGCGGAGGCGGCCGTGACGGCGAAGACGGCCGCCAGGCCGAGAAGCGCC
GACCGCCGGTCCTTGGCCGGGGCGACCTGCACGCGCTTTGCCGCCGCCGGCGAGGCGGACTGCGGCACCGCCGCGGCGGGCTTGAGGCCGACCACACTGG
TGTTCACGCCGGCCATGATCCTCTCGAGGTTTTCTTGATGAATCTGGTGTGTGTGCGTGTGTGGAGAGAGAG
page-top