Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35227  (registered. 2012)
Contig Information
Length 718 bp
Clones alternative view 54 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VABA Shoot with ABA treatment 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 16
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 9
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 6
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XF Seedling, infected with leaf rust 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|71534922|gb|AAZ32865.1|| thioredoxin h [Medicago sativa]
Score 162
Evalue 4.00E-38
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35227
GAGACACAGAGCTACAAGCAGAACAGAAGAGGCACGCAAGCGTGAGAAAGAAGCGAGAGACATGGCGGAGGAGGGGAAGGTGATCGCGATCCACAGCCAG
GAGCAGTGGAGCACCAAGATCGAGGAGGCTGGCAGCAGCACGAATCTGGTGGTGATCGACTTCACTGCAACATGGTGCGGACCATGCCGCTTCATTTCTC
CAATCTTAGATGAGATTGCCAAGAAGCTTCCAAGTGTTACTTTCCTGAAGGTGGATGTTGATGAAATGAAGTCAATTGCCGAGGAGTTCAGTGTTGAGGC
CATGCCGACGTTTGTGCTCATGAAGGAAGGAAAGGTGGTGGACAAGGTTGTGGGAGCTGCCAAGGAGGAGCTGAGCGGGAAGATTGCCAAGCACAGTGCA
ACTGCATGCGCTAAATAAAATGGCCCTTCAACTCTGAATTCGAGAATAAGATGTGTGTCAGCCGCTGCTTGCTACTACCGCTCAACTCATGGATAAGCTG
GCACCGGTGCAGATAGGGTACGTAATGTAATGTTAAACCCTGTTAATCGCGCGGCGCACACGTACTGGCGACAAACTGTATGTGGTGATAACATCGGTCC
ACGAATAAAAAAGAAACCCCGTGTGCCCAAGGTTCAAAAAAAAAAAATGCAACGGAGAATTCATCGCCTGCGATACGGAAATGACATCGCACACACTTTG
ATTGAGCGAAAAAAAAAA
page-top