Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35218  (registered. 2012)
Contig Information
Length 1935 bp
Clones alternative view 20 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_VWD Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115456932|ref|NP_001052066.1|| Os04g0119500 [Oryza sativa (japonica cultivar-group)]
Score 650
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35218
GCTGGACTCTGCCGCCTGCTAAATCTATCTCCTCCCGACGGCCTCGCCTTATCCCCAGCGCAGCGCGCACGCATCCATCTCCCACCCCGCGCCCGCGCGC
CACACATTCCTCGCGCTCCTGCGCCCACAACCATCTCTTCTCCCCACCCCGATCTTGGATTCTTCCGCCGCCCATCTGTCTTCTGTGCCCGCCGTGCACC
GCGCGCGGTTTATAGGCTCACGCCGCTCCAACCAGGGCCGGCCCTGACCACGCACTAGCCACGCGTGAGTCCCTTGATTCATTCATACACTACCACACCC
ACGACTACCAACACACCTCGAGCGAGTTTCCTGCCTGCCCACGATTCTGCGATACAACAACAACAACATGTCGGTGCTGGCGGAGGTCTTCCGGGAGCCC
ACCCTGGCCGGGGTGGCGCGGGAGCTGGCCACCCTCGCCGCGCCGCTCTGGCTTGCCGCCCTCGTCGGCCTGCTCATCGGCTGGGCCTGGCGCCCGCGCT
GGGCAGCCGCAGTCGTCGACGTCGCCGGCAACAACCACCACGAGCCTGTCGCCGCAGCGGCGGCGCCCGCCACCGTCGCCGACCACTTCGCCATCGTACC
TAGAGCTAAGCCGGCCTCTGTGGCGCCCGTGACGGAGGAAGAGGAATTGGCGGTCAGCACCCCGGACCTCATGCACCTCCGCAGGGTCGTTGAAGAGAAG
GACGGCGGCCCCGCCTGGACGCACATGATGGACCGCACGCTCCAGACATTCCGCTACCAGGCCTGGAAAAGAGAACCCCAGAACGGCCCGCCGCAGTACC
GCAGCAGCACCATCTTCGAAGACGCGTCGCCCGATGTCGTCAGGGATTTCTTCTGGGACGATGACTTCCGGATCAGCAACACCTGGGACGACATGCTCCT
TGAGCACGACACGCTGGAGGAGTGCACGAAGACGGGGACGATGGTTGTTCGCTGGGTCAGGAAGTTTCCGTTCTTCTGCAGCGACAGGGAGTATGTTATC
GGTCGCAGGATATGGGCATCTGGAAAGACCTACTACTGCGTTACCAAGAGCGTGCCTCGTCCCTCTGTTCCAAGGTGCAGCAAACCTCGCCGTGTGGACC
TGTATTACTCTAGCTGGTGCATCCGTCCAGTTGAATCAAGAAACGGCGATGGGGCAATGACGGCATGCGAGGTGCTCCTGTTTCATCACGAAGACATGGG
TATCCCATGGAGCATCGCGAAGCTCGGCGTGCAGCAGGGTATGTGGGGCTGCGTCAAACGGATCGAGCCTGGCCTACGGGCATACCAGACCGCAAGGGCC
TCCGGTGAGCCCATCTCGAAATGCGCTGCAATGGCACATGCCAACACAAAGTTTGTCGCCGACGAGCTCACCGCTTCAGAGAACAACACCGAGGCCGGTT
CGACCAGCAACAACGCCCAAGCCGAGAAGCCGAAGCACTGGACGGGCAACCTACCCAAGGTCTTCGTGATAGGCAGCGTGGTCGCCCTGGCTTGCACCTT
CGACAAGGGGCTACTGACCAAGGCCCTCGTGTTCGGAACGGCGAGAAGGTTTGCAGGACCAGGAAGAAGATAGGAACCAAACATCGACGATCCATGACGC
GCATTTGTTCCGATGCACAACCGAGCGAGCGATGCTACCCGGTATTATTTTCGGTCCTGAGACGCTCGTGCTTGCAGATGAGGACGAGGACGGCGTTTGC
TCATGCTAGAGAGCATCTGTAAGCAGGCTTGTGTACATACTGCTGTAGCTGCAGTCTGTGAAGCTGAGAGCTGATTAGGATATGGAACCATGATGATAAT
GAGACTGAATTGTATTGGATGCTGAGACATGGCCATCATCATCATTATGATGATGATGTACTACAATGAATAAGGCTCATATTTTGGAGGTGCTATAAAA
ACATAGTGCTTTTTGTTGGTTGGTCAAAAAAAAAA
page-top