Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35211  (registered. 2012)
Contig Information
Length 1696 bp
Clones alternative view 58 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_oh Pistil at heading date 2
Wh_r Root 1
Wh_DPA20 Seed DPA20 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 3
WH_XN Leaves, plant was grown at constant 23 5
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 12
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 6
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XV Leaves, plant was grown at constant 23 5
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115441829|ref|NP_001045194.1|| Os01g0916400 [Oryza sativa (japonica cultivar-group)]
Score 949
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35211
TTTTTTTTTCAGAATCAGAGGCAACTCTTATTAGGGCACAAGCTCCCATGAAGCCAATGTCAGAGGTTCTATCAGGAACTTATTCCAATTGATACCACAT
CACATACAACACCGCAGGCAGGGAAGAAACCATCTTAATTACAGTGAGCTTAACACCATGGATCTCCAGCTGCATATGCACCCTACACCCTTCGTCCTAG
ATCCATATGTCAGAGGTGCAGTCTCCCCCAGGATATCTCATTTCATGGGCCAATGAGGGACCTTCAGGCTCGGTGCCAAAATCCACAAAGAAGTCGGGGT
TGACAGTCAGCCCTCCTTCCTCGGTGTCGACGTCGATCTGCAACATGTGAGATCCCTTCTTGAGAAGGTCAGGGCCATAGAACTGCTCGTCCCATCGGCT
GAAGAGAGAGTTGGTTACATAGACCCTCTTGCCATCCAAGCTCAGCTGAATCATCTGCGGCCCACCTCTAAGCCGGTGCCCCTTGACTTGGGGCACAGCA
TACTGCTCTTCTTTGTCATCGTCGGTCACATAGACAACATCACTGCCCTTTTGAAGAAGCCCACCTACAAATACTTGCCCAGCCAACACAGGCTTTGCAG
GGTCCTCAATGTTGTACTGCCTGATATCCCCATGAAGCCAGTTGACCAAGTAGAGATAACGGTCATCGAGAGAGATGACAAAGTCAGTTATCAATCCTGG
CATTTCTGGCAGCATCCAGTTGCGCACCTTCAGTGGCTCTATGGATATAGCTACCTCATGGCTCCATGATCCATCTGCAGTTTTGAAGAATCTCACCATG
TTGCTTGTCAAAGCACAGCCAACATAGCCAGTGTCCTTTGATGGGTCATGTAAAAACCTCACCTCCAGTGGAAGAAGACCTGTGCTGCCTAGATCCAGTG
TCTGCTTGAGCTCACCACCAGGCCAGTCATACACATGCAGGTGCCTTCCATAGAGACCATCCTGGACATGCTGGAGATCGAAACCTGTCCTGAAAGCTGC
CGGAGCTCCCCATGAAGAGCTAATCATCGTCTTGTGACGAGGCTGGTACCAGAAATCATAGCCAAACAAGGGGCTGTGACCTGGCTTTTCCCAACGCCCT
TTGACGTTAAACTCTGAATCCAACAGGAGAAAGCCATTGCCAGCAGCATTGCCCTCCTTGTCTCCCAGGCAGGAAATCATGATATCCCCAGTTGCAAGGC
AATGGGATGTGTGAGGGAACCCAAGCCCGGTCTTCTCAGCAATGTCCTCAGCCTGGACAACCTTGTGCAGAGCAGGCGCCCTCGGATCCTTTGCAGTGTC
GACCACATACACGCGACCAGACAGCAACGAAGGGAGAATCAAGAAGCGCCGGCTCGTGGATGGATCACCATGGCAGGAGCTGCAAGCGTTCCAGCCGGAG
TGATGCAGCTCGTCGCCGATGTGGGTGGCCGGGAGCCTGTGGATCACCTGGGAGTAGGTCGCTGAATTGGGGTCGACGTCCACTGTAGCCAGGTAATCCG
GCTTGTTGATTCCAGTACCATTGTAGACGCAGGTGACGTAGAGGAGCCCCTCCCGCGGGCCCTTCTCCATGGCCTCCCTGGGCGTGGCGTACCCGGGGCC
CTTCGCCGCGCAGCACCCCGCCCCGGCGCCGTTCGCCTTCGCCACCGCCGGCACCGCCGCGTCAGCCACCGCTGCGGCCATCGGAGGGTAGGAGTT
page-top