Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig352  (registered. 2012)
Contig Information
Length 1003 bp
Clones alternative view 51 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 3
Wh_r Root 2
Wh_CSEC Callus 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 3
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_OKCS Seed DPA5 4
Wh_RDr Root of dessiccated seed 1
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 3
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 3
WH_XC Root, treated at 50 microM Al for 6h 6
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|85375922|gb|ABC70183.1|| vacuolar ATP synthase subunit E [Triticum aestivum]
Score 444
Evalue 1.00E-122
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig352
CCGTGGACTCCCTCGCGCCCTCCCTCCTCCTGTCGTGTCCTCCCACACCCCCGCGCGGTGGTCGCCGGAAGCAGCGCCCCACAGTCGGACAATCGTCAGA
TCCGCCGCCGCCGACGCCACGATGAACGACACCGATGTCTCCAAGCAGATCCAGCAGATGGTGCGGTTCATCCGCCAGGAGGCCGAGGAGAAGGCTGGCG
AGATCTCCGTCTCCGCTGAGGAGGAATTCAACATTGAGAAGCTGCAACTTGTTGAAGCTGAGAAAAAGAAGATCAGGCAAGAATATGAGCGGAAAGAGAA
GCAGGTTGATGTTCGGAAGAAAATTGAGTACTCTATGCAGCTGAATGCTTCTCGCATCAAAGTGCTTCAGGCCCAGGATGACCTGGTTAATAAAATGAAA
GAGGATGCAATGAAGGAACTCCTGAATATCAGCAGCAACCACCATGAATACAAGAATCTGTTAAAAGAACTCGTTGTTCAGGGCCTGCTTCGGTTGAAAG
AGCCAGCTGTACTGCTCCGCTGCCGCAAAGAAGATCACCATAATGTGGAATCTGTACTGCATTCAGCAAAGAATGAGTATGCATCAAAAGCAGATGTCCA
TGAGCCCGAGATACTAGTTGACCACAGTGTCTACCTGCCACCTTCTCCGAGCCATGGCGATGAGCACGGCCAGATTTGCCATGGAGGTGTTGTGCTGGCT
TCTCGAGATGGAAAGATTGTGTTTGAGAATACAGTTGATGCAAGGCTTGAAGTTGTTTTCCGCAAGAAATTGCCAGAGATCCGGAAGCTTCTTGTTGCGG
CATAATGCGCACTTGTATTTTGGTGATGGTACAGCTGTTTCTATGTAAAATGGCTGCTGGTTTGACCCCCAGCAGGTGCAACGAACTCCGCCCGGTTTTG
CGAACATTGATTGTTTAAAGTATTCCATCCTCTTATGTAAACACTACCTATTTGTTCATTATCGTCGCCGAGCACAAACTATTTGCACGAACTTTGCTCT
GAG
page-top