Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35182  (registered. 2012)
Contig Information
Length 1544 bp
Clones alternative view 31 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VHS Shoot with heat shock treatment 6
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 5
WH_XN Leaves, plant was grown at constant 23 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 4
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|17225494|gb|AAL37431.1|AF327413_1|AF327413_1 translational elongation factor Tu [Oryza sativa]
Score 828
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35182
TGGCCTCCCTCGCCGCCGCCTCCGCCTCCACGGCGCTCCTCTTCCCCTCCACCTCCTCCTCCAAGCCCCGCCTCCCGCTCTCCACATCCCTTGGCTTCTC
CGCGCCCGCGCGGTCACGCCGCGCCACTGCGGTGGCGGGGAGCTCCGGCAGGCGCCCGGGGCTGCTCGTCGTGCGCGCCGCCAGGGGCAAGTTCGAGCGG
AACAAGCCCCACGTCAACATCGGCACCATCGGCCACGTCGACCACGGCAAGACCACCCTCACCGCCGCGCTCACCATGGTGCTCGCCTCCGTCGGGGGCA
GCGCGCCCAAGAAGTACGACGAGATCGACGCCGCCCCTGAGGAGCGCGCCCGTGGTATCACCATCAACACCGCCACCGTCGAGTACGAGACGGAGACGCG
CCACTACGCGCACGTCGACTGCCCCGGTCACGCCGACTACGTCAAGAACATGATTACCGGGGCCGCCCAGATGGACGGCGCCATCCTCGTCGTCTCCGGC
GCCGACGGCCCCATGCCGCAGACCAAGGAGCACATCCTGCTCGCCAAGCAGGTCGGTGTCCCCAGCATTGTTGTTTTCCTCAACAAGAAGGACCAGGTCG
ACGACGAGGAGCTGCTCGAGCTCGTCGATCTCGAGGTCCGCGAGCTGCTCACGGCCTATGAATACGATGGTGACAATGTGCCAATCGTCTCCGGCTCTGC
ACTCAGAGCGCTCGAGGCCCTCATGGCCACCCCTGGCCTCAAGCGTGGGGATAACGAGTGGGTGGATGGCATCTTCTCCTTGATTGATTCCGTGGATACC
CACATCCCTGTCCCGCAGAGGCAGACCGACCTCCCCTTCTTGCTCGCTGTTGAGGATGTTTTCTCCATCACTGGTCGTGGTACAGTTGCCACTGGCCGTA
TCGAGCGTGGCACCGTCAAGGTTGGGGACCCAGTCGACCTCGTCGGCATCAGGGAGACCCGCAATGCCACGGTCACTGGTGTTGAGATGTTCCAGAAGAC
CATGGATGATGCCATTGCTGGGGACAATGTTGGGCTTCTGCTCCGTGGTATGCAGAAGGAAGACATTGAGAGAGGCATGGTGTTGGCAAAGCCCGGTTCC
ATCACGCCACACACCAAGTTTGAGGCTGTTGTGTATGTGCTCAAGAAGGAGGAGGGTGGCCGGCACTCCCCATTTTTCCCTGGTTACCGTCCGCAATTCT
ACATGCGGACTACTGATGTCACGGGGAATGTGACAAACATTATGAACGACAAGGATGAGGAGGCGAAGATGTGCATGCCAGGTGACCGTATCAAGATGGT
TGTGGAGCTCATCCAGCCTGTGGCTTGTGAGCAGGGAATGAGGTTTGCCATCCGTGAAGGTGGCAAGACCGTCGGTGCCGGTGTCATCAATAATATCATT
CAGTAATGTGGATGGAGGATATCCACCGTGAGAATTTTCCTCATTTACTCTTTTGCGAAATGCTATGTAGTTGTTATTATGCGTTTAGGGAAGGCTCTTG
TGAAATTGTAGTATGGCACATTTTTCTTCAAGTGAAATTGCATA
page-top