Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig35125  (registered. 2012)
Contig Information
Length 699 bp
Clones alternative view 32 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 3
Wh_VABA Shoot with ABA treatment 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XV Leaves, plant was grown at constant 23℃ 3
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 12
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125525558|gb|EAY73672.1|| hypothetical protein OsI_01556 [Oryza sativa Indica Group]
Score 169
Evalue 3.00E-40
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig35125
TTTTTTTTTTGGAAAAGGAGGATCAGACTCGCGCCTCTACACCATACCCATGCACACATCCATATTACTTTTTTAAATAAACGTCTGTAATATCAATTGT
ATATCAACCACGTATGTCCCTGGGAAAATATTTGGCGCGTTTTTACTACATACATCCCGATCGTGTAAGTAACGGTAGGTTGAGACATAGCAGGTTTCTC
GGGCTCCCATGAGCCAAGAACACCACGTCCAGCTTCACTATCCGCCGTCCAGAACAAATTAGCACGTACGCTCAGCTGTCGTAGGTGCGGCACTCGTCGG
TCTCGGGGTTCTCCTTGCAGTAGTTCTCGAGCGGGTCCGAGTCCTTGAGCTTGTCCCGGGCGTGGCTGGCCGCGGCGCTGAGCTCCTCCACCTCGTCCCA
CGCCGCGGCGCACTCCCCGCTGGCGGCGTCCTCCGAGCACGTCTCCTGGGCCTCCTTGATGCTGTCCGACATCTTGTCGGAGATGCCCGGCGGCGTGGCC
GGCCCGCCCGCCCTGCAGGAGAGGGCGCCGCTGCCGCGGTACGCCGTCGGGAAGGTGACGCGGGCGGGGGCCACCTGCGGCCTCGCCAGGACGTCGCCCC
TGGCCGTGGGCGCGAAGGTAGACAGGCTCACGTTGGTGAGCGCGGACGCCATTGCAGGGTGTGGTGGATCGGCCGAAATTTTATGTGGTTAGGCCCCGG
page-top